Incidental Mutation 'R8933:Igf2r'
ID 680485
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12704637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1186 (T1186M)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: T1186M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: T1186M

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,128,137 I1114N probably damaging Het
Ache C A 5: 137,290,187 R52S possibly damaging Het
AI182371 A T 2: 35,085,702 probably null Het
Ankrd17 T C 5: 90,258,466 S1453G probably damaging Het
Arvcf A G 16: 18,400,095 N508S probably damaging Het
Aurkc A C 7: 7,002,797 D136A possibly damaging Het
Bfsp2 A G 9: 103,448,649 M265T probably benign Het
Bmpr1b T C 3: 141,856,608 T273A probably damaging Het
Cacnb1 T C 11: 98,005,752 K406R probably damaging Het
Calcoco2 C T 11: 96,107,426 probably benign Het
Capza1 T C 3: 104,840,893 probably null Het
Ccdc63 T A 5: 122,113,202 I382F probably damaging Het
Cep350 A T 1: 155,863,415 N2227K probably benign Het
Chia1 T A 3: 106,129,017 Y304* probably null Het
Col5a2 G A 1: 45,421,963 P258L Het
Cyp21a1 A G 17: 34,804,311 L30P probably damaging Het
Dennd4b T A 3: 90,279,216 H1351Q probably benign Het
Dnah9 T A 11: 65,855,252 I4012F possibly damaging Het
Drd1 A G 13: 54,053,271 I301T possibly damaging Het
Dzip1 T A 14: 118,906,914 H369L probably damaging Het
Fgfrl1 T A 5: 108,703,391 M58K probably damaging Het
Ftsj3 G T 11: 106,250,834 D529E probably benign Het
Fut9 A T 4: 25,619,861 W318R probably damaging Het
Gabrg3 A G 7: 56,984,958 I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 D53V probably benign Het
Ggps1 A G 13: 14,054,343 V85A probably benign Het
Gm5141 C T 13: 62,777,040 W18* probably null Het
Grik5 T A 7: 25,023,318 T518S probably benign Het
Hapln3 A T 7: 79,117,630 probably benign Het
Hbs1l C T 10: 21,367,685 Q646* probably null Het
Hmox1 T C 8: 75,097,016 I104T probably benign Het
Ifit1bl1 T C 19: 34,594,013 Y348C probably damaging Het
Igfbp1 T C 11: 7,198,333 probably null Het
Ikbip C A 10: 91,083,230 A35E probably benign Het
Isca1 C T 13: 59,769,683 A8T probably damaging Het
Itgb2 T C 10: 77,565,188 L754P probably damaging Het
Itgb6 C T 2: 60,627,903 C502Y probably damaging Het
Kdm3a A G 6: 71,600,108 V741A probably benign Het
Kdsr T C 1: 106,753,219 D83G possibly damaging Het
Kiz T A 2: 146,942,117 N523K Het
Kmt2a T C 9: 44,822,505 probably benign Het
Krt25 T C 11: 99,321,238 E191G probably benign Het
Lipn A G 19: 34,069,480 I61V probably damaging Het
Lmbr1l T A 15: 98,909,269 probably null Het
Lrrc4c A G 2: 97,629,481 K151E probably benign Het
Mab21l3 T C 3: 101,823,458 Q155R probably benign Het
Mtfr2 G A 10: 20,357,528 R281H possibly damaging Het
Muc5ac A G 7: 141,789,756 Y35C possibly damaging Het
Myadm C T 7: 3,296,917 T65I probably benign Het
Nap1l1 T C 10: 111,492,849 V213A probably benign Het
Nav2 A G 7: 49,461,957 D737G probably damaging Het
Ndst4 T A 3: 125,611,506 V470D probably damaging Het
Nek5 T A 8: 22,111,210 Y165F probably damaging Het
Nek5 A T 8: 22,120,843 V48E probably damaging Het
Nr6a1 T C 2: 38,760,388 I77V probably damaging Het
Nvl A T 1: 181,139,073 D93E probably benign Het
Olfr450 A G 6: 42,818,016 T182A probably benign Het
Olfr552 A T 7: 102,604,430 L25F probably damaging Het
Olfr656 A T 7: 104,617,666 T4S probably benign Het
Olfr678 A G 7: 105,069,392 probably benign Het
Olfr780 A T 10: 129,322,390 I256F probably damaging Het
Olfr96 C A 17: 37,225,455 T110K possibly damaging Het
Pla2g4c G A 7: 13,339,702 V225I probably benign Het
Plppr4 T A 3: 117,323,041 N331I probably damaging Het
Ptpn13 A G 5: 103,579,805 R2051G probably benign Het
Rbm45 T C 2: 76,378,724 S346P probably damaging Het
Samd14 A C 11: 95,021,201 D168A probably damaging Het
Slc15a1 C T 14: 121,486,679 G172R probably benign Het
Slco3a1 G T 7: 74,284,500 Y641* probably null Het
Srcap G A 7: 127,552,394 R2027H probably damaging Het
Stra8 A T 6: 34,927,689 probably benign Het
Syt11 T C 3: 88,747,704 Y430C probably damaging Het
Tanc1 T G 2: 59,785,456 V269G possibly damaging Het
Tead1 A G 7: 112,898,611 N342S probably benign Het
Tenm3 C T 8: 48,279,060 A1254T possibly damaging Het
Txlnb A T 10: 17,806,798 N156I probably damaging Het
Ufl1 A T 4: 25,262,258 S409R possibly damaging Het
Usp17la A G 7: 104,861,100 H304R probably benign Het
Vmn1r203 T A 13: 22,524,521 H157Q possibly damaging Het
Vmn1r37 C T 6: 66,732,247 R249* probably null Het
Vmn2r96 A G 17: 18,583,979 Q497R probably benign Het
Vps39 A G 2: 120,338,585 S292P probably benign Het
Wnk1 A G 6: 120,036,998 V212A probably damaging Het
Xbp1 T C 11: 5,524,741 V161A probably benign Het
Zfp113 T C 5: 138,144,830 Q386R probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
outlier UTSW 17 12695314 missense probably benign 0.20
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 splice site probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3884:Igf2r UTSW 17 12709468 missense probably benign
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
R7619:Igf2r UTSW 17 12698273 missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12735991 missense probably damaging 0.98
R7733:Igf2r UTSW 17 12739369 missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12748704 missense probably benign
R8022:Igf2r UTSW 17 12718795 missense probably damaging 1.00
R8138:Igf2r UTSW 17 12701238 missense probably benign 0.32
R8220:Igf2r UTSW 17 12692071 missense probably benign 0.22
R8305:Igf2r UTSW 17 12733860 missense probably benign
R8359:Igf2r UTSW 17 12683861 missense probably benign
R8500:Igf2r UTSW 17 12709441 missense probably damaging 0.99
R8510:Igf2r UTSW 17 12704313 missense probably benign 0.38
R8933:Igf2r UTSW 17 12701244 missense probably damaging 0.97
R8976:Igf2r UTSW 17 12726772 missense probably damaging 1.00
R8994:Igf2r UTSW 17 12716650 missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12751293 start codon destroyed probably null
R9097:Igf2r UTSW 17 12691213 missense probably damaging 1.00
R9127:Igf2r UTSW 17 12739351 missense probably damaging 0.98
R9278:Igf2r UTSW 17 12695353 missense probably damaging 1.00
R9362:Igf2r UTSW 17 12722175 missense probably benign 0.02
R9371:Igf2r UTSW 17 12705759 missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12698328 missense probably benign 0.26
R9567:Igf2r UTSW 17 12686754 missense probably damaging 1.00
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Z1177:Igf2r UTSW 17 12697399 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCAAGGGTTCAGTACTG -3'
(R):5'- AAGCAGCCTTTCCTCATTCG -3'

Sequencing Primer
(F):5'- TCAGTACTGACGGACGATTATAAGCC -3'
(R):5'- CTTGTCTGTTCAGGCATTGC -3'
Posted On 2021-08-31