Mutagenetix > Incidental Mutation

Incidental Mutation 'R8933:Igf2r'

680485

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

068709-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R8933 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12704637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1186 (T1186M)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: T1186M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: T1186M

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,128,137	I1114N	probably damaging	Het
Ache	C	A	5: 137,290,187	R52S	possibly damaging	Het
AI182371	A	T	2: 35,085,702		probably null	Het
Ankrd17	T	C	5: 90,258,466	S1453G	probably damaging	Het
Arvcf	A	G	16: 18,400,095	N508S	probably damaging	Het
Aurkc	A	C	7: 7,002,797	D136A	possibly damaging	Het
Bfsp2	A	G	9: 103,448,649	M265T	probably benign	Het
Bmpr1b	T	C	3: 141,856,608	T273A	probably damaging	Het
Cacnb1	T	C	11: 98,005,752	K406R	probably damaging	Het
Calcoco2	C	T	11: 96,107,426		probably benign	Het
Capza1	T	C	3: 104,840,893		probably null	Het
Ccdc63	T	A	5: 122,113,202	I382F	probably damaging	Het
Cep350	A	T	1: 155,863,415	N2227K	probably benign	Het
Chia1	T	A	3: 106,129,017	Y304*	probably null	Het
Col5a2	G	A	1: 45,421,963	P258L		Het
Cyp21a1	A	G	17: 34,804,311	L30P	probably damaging	Het
Dennd4b	T	A	3: 90,279,216	H1351Q	probably benign	Het
Dnah9	T	A	11: 65,855,252	I4012F	possibly damaging	Het
Drd1	A	G	13: 54,053,271	I301T	possibly damaging	Het
Dzip1	T	A	14: 118,906,914	H369L	probably damaging	Het
Fgfrl1	T	A	5: 108,703,391	M58K	probably damaging	Het
Ftsj3	G	T	11: 106,250,834	D529E	probably benign	Het
Fut9	A	T	4: 25,619,861	W318R	probably damaging	Het
Gabrg3	A	G	7: 56,984,958	I159T	probably damaging	Het
Gabrr1	A	T	4: 33,146,972	D53V	probably benign	Het
Ggps1	A	G	13: 14,054,343	V85A	probably benign	Het
Gm5141	C	T	13: 62,777,040	W18*	probably null	Het
Grik5	T	A	7: 25,023,318	T518S	probably benign	Het
Hapln3	A	T	7: 79,117,630		probably benign	Het
Hbs1l	C	T	10: 21,367,685	Q646*	probably null	Het
Hmox1	T	C	8: 75,097,016	I104T	probably benign	Het
Ifit1bl1	T	C	19: 34,594,013	Y348C	probably damaging	Het
Igfbp1	T	C	11: 7,198,333		probably null	Het
Ikbip	C	A	10: 91,083,230	A35E	probably benign	Het
Isca1	C	T	13: 59,769,683	A8T	probably damaging	Het
Itgb2	T	C	10: 77,565,188	L754P	probably damaging	Het
Itgb6	C	T	2: 60,627,903	C502Y	probably damaging	Het
Kdm3a	A	G	6: 71,600,108	V741A	probably benign	Het
Kdsr	T	C	1: 106,753,219	D83G	possibly damaging	Het
Kiz	T	A	2: 146,942,117	N523K		Het
Kmt2a	T	C	9: 44,822,505		probably benign	Het
Krt25	T	C	11: 99,321,238	E191G	probably benign	Het
Lipn	A	G	19: 34,069,480	I61V	probably damaging	Het
Lmbr1l	T	A	15: 98,909,269		probably null	Het
Lrrc4c	A	G	2: 97,629,481	K151E	probably benign	Het
Mab21l3	T	C	3: 101,823,458	Q155R	probably benign	Het
Mtfr2	G	A	10: 20,357,528	R281H	possibly damaging	Het
Muc5ac	A	G	7: 141,789,756	Y35C	possibly damaging	Het
Myadm	C	T	7: 3,296,917	T65I	probably benign	Het
Nap1l1	T	C	10: 111,492,849	V213A	probably benign	Het
Nav2	A	G	7: 49,461,957	D737G	probably damaging	Het
Ndst4	T	A	3: 125,611,506	V470D	probably damaging	Het
Nek5	T	A	8: 22,111,210	Y165F	probably damaging	Het
Nek5	A	T	8: 22,120,843	V48E	probably damaging	Het
Nr6a1	T	C	2: 38,760,388	I77V	probably damaging	Het
Nvl	A	T	1: 181,139,073	D93E	probably benign	Het
Olfr450	A	G	6: 42,818,016	T182A	probably benign	Het
Olfr552	A	T	7: 102,604,430	L25F	probably damaging	Het
Olfr656	A	T	7: 104,617,666	T4S	probably benign	Het
Olfr678	A	G	7: 105,069,392		probably benign	Het
Olfr780	A	T	10: 129,322,390	I256F	probably damaging	Het
Olfr96	C	A	17: 37,225,455	T110K	possibly damaging	Het
Pla2g4c	G	A	7: 13,339,702	V225I	probably benign	Het
Plppr4	T	A	3: 117,323,041	N331I	probably damaging	Het
Ptpn13	A	G	5: 103,579,805	R2051G	probably benign	Het
Rbm45	T	C	2: 76,378,724	S346P	probably damaging	Het
Samd14	A	C	11: 95,021,201	D168A	probably damaging	Het
Slc15a1	C	T	14: 121,486,679	G172R	probably benign	Het
Slco3a1	G	T	7: 74,284,500	Y641*	probably null	Het
Srcap	G	A	7: 127,552,394	R2027H	probably damaging	Het
Stra8	A	T	6: 34,927,689		probably benign	Het
Syt11	T	C	3: 88,747,704	Y430C	probably damaging	Het
Tanc1	T	G	2: 59,785,456	V269G	possibly damaging	Het
Tead1	A	G	7: 112,898,611	N342S	probably benign	Het
Tenm3	C	T	8: 48,279,060	A1254T	possibly damaging	Het
Txlnb	A	T	10: 17,806,798	N156I	probably damaging	Het
Ufl1	A	T	4: 25,262,258	S409R	possibly damaging	Het
Usp17la	A	G	7: 104,861,100	H304R	probably benign	Het
Vmn1r203	T	A	13: 22,524,521	H157Q	possibly damaging	Het
Vmn1r37	C	T	6: 66,732,247	R249*	probably null	Het
Vmn2r96	A	G	17: 18,583,979	Q497R	probably benign	Het
Vps39	A	G	2: 120,338,585	S292P	probably benign	Het
Wnk1	A	G	6: 120,036,998	V212A	probably damaging	Het
Xbp1	T	C	11: 5,524,741	V161A	probably benign	Het
Zfp113	T	C	5: 138,144,830	Q386R	probably damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGCCAAGGGTTCAGTACTG -3'
(R):5'- AAGCAGCCTTTCCTCATTCG -3'

Sequencing Primer
(F):5'- TCAGTACTGACGGACGATTATAAGCC -3'
(R):5'- CTTGTCTGTTCAGGCATTGC -3'

Posted On

2021-08-31