Incidental Mutation 'R8933:Vmn2r96'
ID 680486
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Name vomeronasal 2, receptor 96
Synonyms EG433070
MMRRC Submission 068709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 18793282-18818419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18804241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 497 (Q497R)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
AlphaFold E9PZU5
Predicted Effect probably benign
Transcript: ENSMUST00000165692
AA Change: Q305R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: Q305R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: Q497R

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: Q497R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: Q497R

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,921,786 (GRCm39) I1114N probably damaging Het
Ache C A 5: 137,288,449 (GRCm39) R52S possibly damaging Het
AI182371 A T 2: 34,975,714 (GRCm39) probably null Het
Ankrd17 T C 5: 90,406,325 (GRCm39) S1453G probably damaging Het
Arvcf A G 16: 18,218,845 (GRCm39) N508S probably damaging Het
Aurkc A C 7: 7,005,796 (GRCm39) D136A possibly damaging Het
Bfsp2 A G 9: 103,325,848 (GRCm39) M265T probably benign Het
Bmpr1b T C 3: 141,562,369 (GRCm39) T273A probably damaging Het
Cacnb1 T C 11: 97,896,578 (GRCm39) K406R probably damaging Het
Calcoco2 C T 11: 95,998,252 (GRCm39) probably benign Het
Capza1 T C 3: 104,748,209 (GRCm39) probably null Het
Ccdc63 T A 5: 122,251,265 (GRCm39) I382F probably damaging Het
Cep350 A T 1: 155,739,161 (GRCm39) N2227K probably benign Het
Chia1 T A 3: 106,036,333 (GRCm39) Y304* probably null Het
Col5a2 G A 1: 45,461,123 (GRCm39) P258L Het
Cyp21a1 A G 17: 35,023,285 (GRCm39) L30P probably damaging Het
Dennd4b T A 3: 90,186,523 (GRCm39) H1351Q probably benign Het
Dnah9 T A 11: 65,746,078 (GRCm39) I4012F possibly damaging Het
Drd1 A G 13: 54,207,290 (GRCm39) I301T possibly damaging Het
Dzip1 T A 14: 119,144,326 (GRCm39) H369L probably damaging Het
Fgfrl1 T A 5: 108,851,257 (GRCm39) M58K probably damaging Het
Ftsj3 G T 11: 106,141,660 (GRCm39) D529E probably benign Het
Fut9 A T 4: 25,619,861 (GRCm39) W318R probably damaging Het
Gabrg3 A G 7: 56,634,706 (GRCm39) I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 (GRCm39) D53V probably benign Het
Ggps1 A G 13: 14,228,928 (GRCm39) V85A probably benign Het
Gm5141 C T 13: 62,924,854 (GRCm39) W18* probably null Het
Grik5 T A 7: 24,722,743 (GRCm39) T518S probably benign Het
Hapln3 A T 7: 78,767,378 (GRCm39) probably benign Het
Hbs1l C T 10: 21,243,584 (GRCm39) Q646* probably null Het
Hmox1 T C 8: 75,823,644 (GRCm39) I104T probably benign Het
Ifit1bl1 T C 19: 34,571,413 (GRCm39) Y348C probably damaging Het
Igf2r A T 17: 12,920,131 (GRCm39) S1403T probably damaging Het
Igf2r G A 17: 12,923,524 (GRCm39) T1186M probably damaging Het
Igfbp1 T C 11: 7,148,333 (GRCm39) probably null Het
Ikbip C A 10: 90,919,092 (GRCm39) A35E probably benign Het
Isca1 C T 13: 59,917,497 (GRCm39) A8T probably damaging Het
Itgb2 T C 10: 77,401,022 (GRCm39) L754P probably damaging Het
Itgb6 C T 2: 60,458,247 (GRCm39) C502Y probably damaging Het
Kdm3a A G 6: 71,577,092 (GRCm39) V741A probably benign Het
Kdsr T C 1: 106,680,949 (GRCm39) D83G possibly damaging Het
Kiz T A 2: 146,784,037 (GRCm39) N523K Het
Kmt2a T C 9: 44,733,802 (GRCm39) probably benign Het
Krt25 T C 11: 99,212,064 (GRCm39) E191G probably benign Het
Lipn A G 19: 34,046,880 (GRCm39) I61V probably damaging Het
Lmbr1l T A 15: 98,807,150 (GRCm39) probably null Het
Lrrc4c A G 2: 97,459,826 (GRCm39) K151E probably benign Het
Mab21l3 T C 3: 101,730,774 (GRCm39) Q155R probably benign Het
Mtfr2 G A 10: 20,233,274 (GRCm39) R281H possibly damaging Het
Muc5ac A G 7: 141,343,493 (GRCm39) Y35C possibly damaging Het
Myadm C T 7: 3,345,433 (GRCm39) T65I probably benign Het
Nap1l1 T C 10: 111,328,710 (GRCm39) V213A probably benign Het
Nav2 A G 7: 49,111,705 (GRCm39) D737G probably damaging Het
Ndst4 T A 3: 125,405,155 (GRCm39) V470D probably damaging Het
Nek5 T A 8: 22,601,226 (GRCm39) Y165F probably damaging Het
Nek5 A T 8: 22,610,859 (GRCm39) V48E probably damaging Het
Nr6a1 T C 2: 38,650,400 (GRCm39) I77V probably damaging Het
Nvl A T 1: 180,966,638 (GRCm39) D93E probably benign Het
Or11a4 C A 17: 37,536,346 (GRCm39) T110K possibly damaging Het
Or2q1 A G 6: 42,794,950 (GRCm39) T182A probably benign Het
Or52e5 A G 7: 104,718,599 (GRCm39) probably benign Het
Or52k2 A T 7: 102,253,637 (GRCm39) L25F probably damaging Het
Or52p1 A T 7: 104,266,873 (GRCm39) T4S probably benign Het
Or6c68 A T 10: 129,158,259 (GRCm39) I256F probably damaging Het
Pla2g4c G A 7: 13,073,627 (GRCm39) V225I probably benign Het
Plppr4 T A 3: 117,116,690 (GRCm39) N331I probably damaging Het
Ptpn13 A G 5: 103,727,671 (GRCm39) R2051G probably benign Het
Rbm45 T C 2: 76,209,068 (GRCm39) S346P probably damaging Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Slc15a1 C T 14: 121,724,091 (GRCm39) G172R probably benign Het
Slco3a1 G T 7: 73,934,248 (GRCm39) Y641* probably null Het
Srcap G A 7: 127,151,566 (GRCm39) R2027H probably damaging Het
Stra8 A T 6: 34,904,624 (GRCm39) probably benign Het
Syt11 T C 3: 88,655,011 (GRCm39) Y430C probably damaging Het
Tanc1 T G 2: 59,615,800 (GRCm39) V269G possibly damaging Het
Tead1 A G 7: 112,497,818 (GRCm39) N342S probably benign Het
Tenm3 C T 8: 48,732,095 (GRCm39) A1254T possibly damaging Het
Txlnb A T 10: 17,682,546 (GRCm39) N156I probably damaging Het
Ufl1 A T 4: 25,262,258 (GRCm39) S409R possibly damaging Het
Usp17la A G 7: 104,510,307 (GRCm39) H304R probably benign Het
Vmn1r203 T A 13: 22,708,691 (GRCm39) H157Q possibly damaging Het
Vmn1r37 C T 6: 66,709,231 (GRCm39) R249* probably null Het
Vps39 A G 2: 120,169,066 (GRCm39) S292P probably benign Het
Wnk1 A G 6: 120,013,959 (GRCm39) V212A probably damaging Het
Xbp1 T C 11: 5,474,741 (GRCm39) V161A probably benign Het
Zfp113 T C 5: 138,143,092 (GRCm39) Q386R probably damaging Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18,804,077 (GRCm39) missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18,804,081 (GRCm39) missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18,803,226 (GRCm39) missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18,817,527 (GRCm39) missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18,804,221 (GRCm39) missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18,817,829 (GRCm39) missense probably benign
IGL02672:Vmn2r96 APN 17 18,818,376 (GRCm39) missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18,802,851 (GRCm39) missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18,803,137 (GRCm39) missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18,806,634 (GRCm39) missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18,802,827 (GRCm39) missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18,804,262 (GRCm39) missense probably benign
R0580:Vmn2r96 UTSW 17 18,802,900 (GRCm39) missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18,817,830 (GRCm39) missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18,802,738 (GRCm39) missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18,817,660 (GRCm39) missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18,817,660 (GRCm39) missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18,817,988 (GRCm39) missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18,802,915 (GRCm39) missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18,818,183 (GRCm39) missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18,806,664 (GRCm39) missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18,804,138 (GRCm39) missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18,804,263 (GRCm39) missense probably benign
R2405:Vmn2r96 UTSW 17 18,818,102 (GRCm39) missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18,817,941 (GRCm39) missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18,818,339 (GRCm39) missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18,803,270 (GRCm39) missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18,803,088 (GRCm39) missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18,817,770 (GRCm39) missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18,817,866 (GRCm39) missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18,802,918 (GRCm39) missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18,804,120 (GRCm39) missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18,817,950 (GRCm39) missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18,818,091 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18,804,221 (GRCm39) missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18,804,126 (GRCm39) missense probably benign
R6339:Vmn2r96 UTSW 17 18,804,124 (GRCm39) missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18,817,793 (GRCm39) missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18,804,117 (GRCm39) missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18,818,352 (GRCm39) missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18,802,116 (GRCm39) missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18,802,800 (GRCm39) missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18,817,891 (GRCm39) missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18,818,100 (GRCm39) missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18,818,283 (GRCm39) missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18,804,082 (GRCm39) missense probably benign
R7149:Vmn2r96 UTSW 17 18,817,989 (GRCm39) missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18,803,029 (GRCm39) missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18,803,302 (GRCm39) missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18,793,662 (GRCm39) missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18,802,995 (GRCm39) missense probably benign 0.02
R7652:Vmn2r96 UTSW 17 18,793,832 (GRCm39) missense probably benign
R7659:Vmn2r96 UTSW 17 18,793,749 (GRCm39) missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18,806,663 (GRCm39) missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18,818,130 (GRCm39) missense possibly damaging 0.59
R8166:Vmn2r96 UTSW 17 18,802,744 (GRCm39) missense probably damaging 1.00
R8260:Vmn2r96 UTSW 17 18,804,243 (GRCm39) missense probably benign 0.04
R8323:Vmn2r96 UTSW 17 18,803,023 (GRCm39) missense probably damaging 0.99
R8787:Vmn2r96 UTSW 17 18,818,250 (GRCm39) missense probably damaging 1.00
R8837:Vmn2r96 UTSW 17 18,802,888 (GRCm39) missense probably benign
R9306:Vmn2r96 UTSW 17 18,803,226 (GRCm39) missense probably benign 0.00
R9481:Vmn2r96 UTSW 17 18,793,621 (GRCm39) start gained probably benign
R9626:Vmn2r96 UTSW 17 18,793,758 (GRCm39) missense probably benign 0.14
R9629:Vmn2r96 UTSW 17 18,803,257 (GRCm39) missense probably benign 0.15
Z1088:Vmn2r96 UTSW 17 18,817,628 (GRCm39) missense possibly damaging 0.86
Z1177:Vmn2r96 UTSW 17 18,818,376 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACTTTCCTGAAGAATATTGTGGTG -3'
(R):5'- GGATTCATTGAACACTGTACTCTTC -3'

Sequencing Primer
(F):5'- TCCTGAAGAATATTGTGGTGAAAGAC -3'
(R):5'- GAACACTGTACTCTTCCATTGATC -3'
Posted On 2021-08-31