Incidental Mutation 'R8933:Lipn'
ID 680489
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34067358-34084918 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34069480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 61 (I61V)
Ref Sequence ENSEMBL: ENSMUSP00000114551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably damaging
Transcript: ENSMUST00000025682
AA Change: I61V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: I61V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126710
AA Change: I61V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: I61V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148821
AA Change: I61V

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770
AA Change: I61V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,128,137 I1114N probably damaging Het
Ache C A 5: 137,290,187 R52S possibly damaging Het
AI182371 A T 2: 35,085,702 probably null Het
Ankrd17 T C 5: 90,258,466 S1453G probably damaging Het
Arvcf A G 16: 18,400,095 N508S probably damaging Het
Aurkc A C 7: 7,002,797 D136A possibly damaging Het
Bfsp2 A G 9: 103,448,649 M265T probably benign Het
Bmpr1b T C 3: 141,856,608 T273A probably damaging Het
Cacnb1 T C 11: 98,005,752 K406R probably damaging Het
Calcoco2 C T 11: 96,107,426 probably benign Het
Capza1 T C 3: 104,840,893 probably null Het
Ccdc63 T A 5: 122,113,202 I382F probably damaging Het
Cep350 A T 1: 155,863,415 N2227K probably benign Het
Chia1 T A 3: 106,129,017 Y304* probably null Het
Col5a2 G A 1: 45,421,963 P258L Het
Cyp21a1 A G 17: 34,804,311 L30P probably damaging Het
Dennd4b T A 3: 90,279,216 H1351Q probably benign Het
Dnah9 T A 11: 65,855,252 I4012F possibly damaging Het
Drd1 A G 13: 54,053,271 I301T possibly damaging Het
Dzip1 T A 14: 118,906,914 H369L probably damaging Het
Fgfrl1 T A 5: 108,703,391 M58K probably damaging Het
Ftsj3 G T 11: 106,250,834 D529E probably benign Het
Fut9 A T 4: 25,619,861 W318R probably damaging Het
Gabrg3 A G 7: 56,984,958 I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 D53V probably benign Het
Ggps1 A G 13: 14,054,343 V85A probably benign Het
Gm5141 C T 13: 62,777,040 W18* probably null Het
Grik5 T A 7: 25,023,318 T518S probably benign Het
Hapln3 A T 7: 79,117,630 probably benign Het
Hbs1l C T 10: 21,367,685 Q646* probably null Het
Hmox1 T C 8: 75,097,016 I104T probably benign Het
Ifit1bl1 T C 19: 34,594,013 Y348C probably damaging Het
Igf2r A T 17: 12,701,244 S1403T probably damaging Het
Igf2r G A 17: 12,704,637 T1186M probably damaging Het
Igfbp1 T C 11: 7,198,333 probably null Het
Ikbip C A 10: 91,083,230 A35E probably benign Het
Isca1 C T 13: 59,769,683 A8T probably damaging Het
Itgb2 T C 10: 77,565,188 L754P probably damaging Het
Itgb6 C T 2: 60,627,903 C502Y probably damaging Het
Kdm3a A G 6: 71,600,108 V741A probably benign Het
Kdsr T C 1: 106,753,219 D83G possibly damaging Het
Kiz T A 2: 146,942,117 N523K Het
Kmt2a T C 9: 44,822,505 probably benign Het
Krt25 T C 11: 99,321,238 E191G probably benign Het
Lmbr1l T A 15: 98,909,269 probably null Het
Lrrc4c A G 2: 97,629,481 K151E probably benign Het
Mab21l3 T C 3: 101,823,458 Q155R probably benign Het
Mtfr2 G A 10: 20,357,528 R281H possibly damaging Het
Muc5ac A G 7: 141,789,756 Y35C possibly damaging Het
Myadm C T 7: 3,296,917 T65I probably benign Het
Nap1l1 T C 10: 111,492,849 V213A probably benign Het
Nav2 A G 7: 49,461,957 D737G probably damaging Het
Ndst4 T A 3: 125,611,506 V470D probably damaging Het
Nek5 T A 8: 22,111,210 Y165F probably damaging Het
Nek5 A T 8: 22,120,843 V48E probably damaging Het
Nr6a1 T C 2: 38,760,388 I77V probably damaging Het
Nvl A T 1: 181,139,073 D93E probably benign Het
Olfr450 A G 6: 42,818,016 T182A probably benign Het
Olfr552 A T 7: 102,604,430 L25F probably damaging Het
Olfr656 A T 7: 104,617,666 T4S probably benign Het
Olfr678 A G 7: 105,069,392 probably benign Het
Olfr780 A T 10: 129,322,390 I256F probably damaging Het
Olfr96 C A 17: 37,225,455 T110K possibly damaging Het
Pla2g4c G A 7: 13,339,702 V225I probably benign Het
Plppr4 T A 3: 117,323,041 N331I probably damaging Het
Ptpn13 A G 5: 103,579,805 R2051G probably benign Het
Rbm45 T C 2: 76,378,724 S346P probably damaging Het
Samd14 A C 11: 95,021,201 D168A probably damaging Het
Slc15a1 C T 14: 121,486,679 G172R probably benign Het
Slco3a1 G T 7: 74,284,500 Y641* probably null Het
Srcap G A 7: 127,552,394 R2027H probably damaging Het
Stra8 A T 6: 34,927,689 probably benign Het
Syt11 T C 3: 88,747,704 Y430C probably damaging Het
Tanc1 T G 2: 59,785,456 V269G possibly damaging Het
Tead1 A G 7: 112,898,611 N342S probably benign Het
Tenm3 C T 8: 48,279,060 A1254T possibly damaging Het
Txlnb A T 10: 17,806,798 N156I probably damaging Het
Ufl1 A T 4: 25,262,258 S409R possibly damaging Het
Usp17la A G 7: 104,861,100 H304R probably benign Het
Vmn1r203 T A 13: 22,524,521 H157Q possibly damaging Het
Vmn1r37 C T 6: 66,732,247 R249* probably null Het
Vmn2r96 A G 17: 18,583,979 Q497R probably benign Het
Vps39 A G 2: 120,338,585 S292P probably benign Het
Wnk1 A G 6: 120,036,998 V212A probably damaging Het
Xbp1 T C 11: 5,524,741 V161A probably benign Het
Zfp113 T C 5: 138,144,830 Q386R probably damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
R8824:Lipn UTSW 19 34084716 missense probably benign 0.04
R8894:Lipn UTSW 19 34084848 makesense probably null
R9054:Lipn UTSW 19 34076976 missense possibly damaging 0.56
R9117:Lipn UTSW 19 34068641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTAGATACCTTCCAGCATTC -3'
(R):5'- CATTAAAAGACCACTGCAGTAACTG -3'

Sequencing Primer
(F):5'- CAACTACCTGCAGCTATAGATTTTG -3'
(R):5'- CTGCAGTAACTGAAGCCAATTTGG -3'
Posted On 2021-08-31