Incidental Mutation 'R8934:Slamf6'
ID 680495
Institutional Source Beutler Lab
Gene Symbol Slamf6
Ensembl Gene ENSMUSG00000015314
Gene Name SLAM family member 6
Synonyms KAL1b, NTB-A, KAL1, Ly108, SF2000
MMRRC Submission 068777-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8934 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 171745002-171776525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 171745338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 22 (L22F)
Ref Sequence ENSEMBL: ENSMUSP00000130610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]
AlphaFold Q9ET39
Predicted Effect possibly damaging
Transcript: ENSMUST00000171330
AA Change: L22F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 7e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194182
SMART Domains Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194561
AA Change: L22F

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 5e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195656
AA Change: L22F

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
IG 39 142 5.9e-5 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 8e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,382,614 (GRCm39) S1117L possibly damaging Het
Abce1 A G 8: 80,429,661 (GRCm39) Y87H probably damaging Het
Adad2 G A 8: 120,341,535 (GRCm39) probably benign Het
Adamts12 A G 15: 11,300,015 (GRCm39) T901A probably damaging Het
Adamts18 T A 8: 114,463,510 (GRCm39) I779F possibly damaging Het
Bod1l T C 5: 41,976,944 (GRCm39) T1457A probably benign Het
Brat1 T C 5: 140,696,004 (GRCm39) V125A probably benign Het
C4b G A 17: 34,951,958 (GRCm39) R1296C possibly damaging Het
C5ar1 A T 7: 15,982,402 (GRCm39) L206Q probably damaging Het
Cfap126 A G 1: 170,953,690 (GRCm39) T87A probably benign Het
Cnot1 A T 8: 96,491,695 (GRCm39) N376K probably benign Het
Cyp3a44 A T 5: 145,731,786 (GRCm39) I120K possibly damaging Het
Ddx17 T C 15: 79,420,217 (GRCm39) E384G possibly damaging Het
Dipk1b G A 2: 26,524,866 (GRCm39) V89M possibly damaging Het
Dnah14 T C 1: 181,450,288 (GRCm39) S634P possibly damaging Het
Dusp16 A T 6: 134,718,639 (GRCm39) probably benign Het
Eml2 G A 7: 18,913,738 (GRCm39) R185H probably damaging Het
Epdr1 T C 13: 19,777,350 (GRCm39) E216G possibly damaging Het
Erv3 T C 2: 131,698,101 (GRCm39) H86R probably benign Het
Gm5114 A G 7: 39,060,553 (GRCm39) W99R probably benign Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Hjv T G 3: 96,433,909 (GRCm39) C27G probably damaging Het
Ifrd2 T C 9: 107,469,469 (GRCm39) probably benign Het
Ikbkb T C 8: 23,150,407 (GRCm39) *758W probably null Het
Il1rap T C 16: 26,495,734 (GRCm39) C114R probably damaging Het
Irf6 T C 1: 192,845,033 (GRCm39) I168T probably benign Het
Kmt2d T C 15: 98,759,767 (GRCm39) I1164V unknown Het
Lamb3 T C 1: 193,021,168 (GRCm39) L915P probably damaging Het
Lca5 T C 9: 83,273,909 (GRCm39) probably benign Het
Lhx3 C A 2: 26,092,258 (GRCm39) R211L probably damaging Het
Mettl8 T C 2: 70,882,062 (GRCm39) probably benign Het
Mroh1 T C 15: 76,334,386 (GRCm39) S1297P probably benign Het
Myh14 T A 7: 44,306,852 (GRCm39) T232S probably benign Het
Nemp2 T A 1: 52,688,868 (GRCm39) F377L probably damaging Het
Obscn A G 11: 58,889,085 (GRCm39) probably null Het
Or4b1b T A 2: 90,112,356 (GRCm39) T188S probably benign Het
Or51ah3 T C 7: 103,210,290 (GRCm39) V202A probably benign Het
Pgbd5 A C 8: 125,110,998 (GRCm39) V231G possibly damaging Het
Pitrm1 T C 13: 6,606,666 (GRCm39) L240P probably benign Het
Pkhd1 A G 1: 20,462,234 (GRCm39) probably null Het
Ppp2r5a T A 1: 191,100,835 (GRCm39) probably benign Het
Pramel31 C T 4: 144,090,345 (GRCm39) L462F possibly damaging Het
Prss30 C T 17: 24,192,628 (GRCm39) C147Y probably damaging Het
Ptpru C T 4: 131,546,297 (GRCm39) V318M probably damaging Het
Rpap1 C T 2: 119,599,730 (GRCm39) probably null Het
Rptn A G 3: 93,303,219 (GRCm39) Q184R probably benign Het
Rufy1 T A 11: 50,298,705 (GRCm39) Q362L probably benign Het
Rundc1 A G 11: 101,322,327 (GRCm39) K274E probably damaging Het
Shroom3 T A 5: 93,089,584 (GRCm39) I778K probably damaging Het
St7l A G 3: 104,796,634 (GRCm39) E249G probably damaging Het
Tmem237 T C 1: 59,153,338 (GRCm39) N61S probably benign Het
Tyk2 T C 9: 21,038,416 (GRCm39) probably benign Het
Ubtf G T 11: 102,204,855 (GRCm39) P115T probably damaging Het
Vmn2r70 T A 7: 85,211,188 (GRCm39) I508F possibly damaging Het
Zfp609 C T 9: 65,610,561 (GRCm39) A801T possibly damaging Het
Zfp663 A T 2: 165,194,714 (GRCm39) C502S probably damaging Het
Other mutations in Slamf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slamf6 APN 1 171,745,347 (GRCm39) missense probably null 0.27
IGL01011:Slamf6 APN 1 171,765,666 (GRCm39) missense probably benign 0.19
P0016:Slamf6 UTSW 1 171,764,068 (GRCm39) missense probably damaging 0.97
R1565:Slamf6 UTSW 1 171,761,975 (GRCm39) missense possibly damaging 0.53
R1763:Slamf6 UTSW 1 171,770,154 (GRCm39) intron probably benign
R1774:Slamf6 UTSW 1 171,770,154 (GRCm39) intron probably benign
R1993:Slamf6 UTSW 1 171,761,776 (GRCm39) missense possibly damaging 0.74
R2155:Slamf6 UTSW 1 171,765,575 (GRCm39) missense probably damaging 0.99
R2328:Slamf6 UTSW 1 171,761,818 (GRCm39) missense probably benign 0.00
R4693:Slamf6 UTSW 1 171,761,680 (GRCm39) nonsense probably null
R5062:Slamf6 UTSW 1 171,764,100 (GRCm39) missense possibly damaging 0.93
R5172:Slamf6 UTSW 1 171,764,147 (GRCm39) missense probably benign 0.01
R5249:Slamf6 UTSW 1 171,764,249 (GRCm39) missense probably damaging 1.00
R5328:Slamf6 UTSW 1 171,765,662 (GRCm39) missense probably benign 0.04
R5771:Slamf6 UTSW 1 171,745,341 (GRCm39) missense probably damaging 0.98
R6339:Slamf6 UTSW 1 171,775,615 (GRCm39) missense probably null 1.00
R6960:Slamf6 UTSW 1 171,745,320 (GRCm39) missense probably damaging 0.98
R7176:Slamf6 UTSW 1 171,761,858 (GRCm39) missense probably benign 0.13
R7400:Slamf6 UTSW 1 171,747,360 (GRCm39) missense unknown
R7535:Slamf6 UTSW 1 171,747,325 (GRCm39) missense unknown
R7629:Slamf6 UTSW 1 171,764,191 (GRCm39) missense probably damaging 0.97
R8202:Slamf6 UTSW 1 171,761,786 (GRCm39) missense probably benign 0.01
R9225:Slamf6 UTSW 1 171,764,270 (GRCm39) missense probably benign 0.25
R9338:Slamf6 UTSW 1 171,747,157 (GRCm39) intron probably benign
R9581:Slamf6 UTSW 1 171,761,897 (GRCm39) missense
RF025:Slamf6 UTSW 1 171,769,149 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTAAGCCAAGTGTGAAGTTAATC -3'
(R):5'- CCTGACTTACAAAGACTCATTTTCC -3'

Sequencing Primer
(F):5'- GTTAATCACGACAACCAAAGGTTTGC -3'
(R):5'- CAGCCGAAGTGTTTGCTCTGAATC -3'
Posted On 2021-08-31