Incidental Mutation 'R8934:Slamf6'
ID 680495
Institutional Source Beutler Lab
Gene Symbol Slamf6
Ensembl Gene ENSMUSG00000015314
Gene Name SLAM family member 6
Synonyms Ly108, SF2000, KAL1, KAL1b, NTB-A
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8934 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 171917515-171953170 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 171917771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 22 (L22F)
Ref Sequence ENSEMBL: ENSMUSP00000130610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]
AlphaFold Q9ET39
Predicted Effect possibly damaging
Transcript: ENSMUST00000171330
AA Change: L22F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 7e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194182
SMART Domains Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194561
AA Change: L22F

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 5e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195656
AA Change: L22F

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: L22F

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
IG 39 142 5.9e-5 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 8e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Abce1 A G 8: 79,703,032 Y87H probably damaging Het
Adad2 G A 8: 119,614,796 probably benign Het
Adamts12 A G 15: 11,299,929 T901A probably damaging Het
Adamts18 T A 8: 113,736,878 I779F possibly damaging Het
Bod1l T C 5: 41,819,601 T1457A probably benign Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
C4b G A 17: 34,732,984 R1296C possibly damaging Het
C5ar1 A T 7: 16,248,477 L206Q probably damaging Het
Cfap126 A G 1: 171,126,121 T87A probably benign Het
Cnot1 A T 8: 95,765,067 N376K probably benign Het
Cyp3a44 A T 5: 145,794,976 I120K possibly damaging Het
Ddx17 T C 15: 79,536,016 E384G possibly damaging Het
Dnah14 T C 1: 181,622,723 S634P possibly damaging Het
Dusp16 A T 6: 134,741,676 probably benign Het
Eml2 G A 7: 19,179,813 R185H probably damaging Het
Epdr1 T C 13: 19,593,180 E216G possibly damaging Het
Erv3 T C 2: 131,856,181 H86R probably benign Het
Fam69b G A 2: 26,634,854 V89M possibly damaging Het
Gm13119 C T 4: 144,363,775 L462F possibly damaging Het
Gm5114 A G 7: 39,411,129 W99R probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hfe2 T G 3: 96,526,593 C27G probably damaging Het
Ifrd2 T C 9: 107,592,270 probably benign Het
Ikbkb T C 8: 22,660,391 *758W probably null Het
Il1rap T C 16: 26,676,984 C114R probably damaging Het
Irf6 T C 1: 193,162,725 I168T probably benign Het
Kmt2d T C 15: 98,861,886 I1164V unknown Het
Lamb3 T C 1: 193,338,860 L915P probably damaging Het
Lca5 T C 9: 83,391,856 probably benign Het
Lhx3 C A 2: 26,202,246 R211L probably damaging Het
Mettl8 T C 2: 71,051,718 probably benign Het
Mroh1 T C 15: 76,450,186 S1297P probably benign Het
Myh14 T A 7: 44,657,428 T232S probably benign Het
Nemp2 T A 1: 52,649,709 F377L probably damaging Het
Obscn A G 11: 58,998,259 probably null Het
Olfr1272 T A 2: 90,282,012 T188S probably benign Het
Olfr615 T C 7: 103,561,083 V202A probably benign Het
Pgbd5 A C 8: 124,384,259 V231G possibly damaging Het
Pitrm1 T C 13: 6,556,630 L240P probably benign Het
Pkhd1 A G 1: 20,392,010 probably null Het
Ppp2r5a T A 1: 191,368,638 probably benign Het
Prss30 C T 17: 23,973,654 C147Y probably damaging Het
Ptpru C T 4: 131,818,986 V318M probably damaging Het
Rpap1 C T 2: 119,769,249 probably null Het
Rptn A G 3: 93,395,912 Q184R probably benign Het
Rufy1 T A 11: 50,407,878 Q362L probably benign Het
Rundc1 A G 11: 101,431,501 K274E probably damaging Het
Shroom3 T A 5: 92,941,725 I778K probably damaging Het
St7l A G 3: 104,889,318 E249G probably damaging Het
Tmem237 T C 1: 59,114,179 N61S probably benign Het
Tyk2 T C 9: 21,127,120 probably benign Het
Ubtf G T 11: 102,314,029 P115T probably damaging Het
Vmn2r70 T A 7: 85,561,980 I508F possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp663 A T 2: 165,352,794 C502S probably damaging Het
Other mutations in Slamf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slamf6 APN 1 171917780 missense probably null 0.27
IGL01011:Slamf6 APN 1 171938099 missense probably benign 0.19
P0016:Slamf6 UTSW 1 171936501 missense probably damaging 0.97
R1565:Slamf6 UTSW 1 171934408 missense possibly damaging 0.53
R1763:Slamf6 UTSW 1 171942587 intron probably benign
R1774:Slamf6 UTSW 1 171942587 intron probably benign
R1993:Slamf6 UTSW 1 171934209 missense possibly damaging 0.74
R2155:Slamf6 UTSW 1 171938008 missense probably damaging 0.99
R2328:Slamf6 UTSW 1 171934251 missense probably benign 0.00
R4693:Slamf6 UTSW 1 171934113 nonsense probably null
R5062:Slamf6 UTSW 1 171936533 missense possibly damaging 0.93
R5172:Slamf6 UTSW 1 171936580 missense probably benign 0.01
R5249:Slamf6 UTSW 1 171936682 missense probably damaging 1.00
R5328:Slamf6 UTSW 1 171938095 missense probably benign 0.04
R5771:Slamf6 UTSW 1 171917774 missense probably damaging 0.98
R6339:Slamf6 UTSW 1 171948048 missense probably null 1.00
R6960:Slamf6 UTSW 1 171917753 missense probably damaging 0.98
R7176:Slamf6 UTSW 1 171934291 missense probably benign 0.13
R7400:Slamf6 UTSW 1 171919793 missense unknown
R7535:Slamf6 UTSW 1 171919758 missense unknown
R7629:Slamf6 UTSW 1 171936624 missense probably damaging 0.97
R8202:Slamf6 UTSW 1 171934219 missense probably benign 0.01
R9225:Slamf6 UTSW 1 171936703 missense probably benign 0.25
R9338:Slamf6 UTSW 1 171919590 intron probably benign
R9581:Slamf6 UTSW 1 171934330 missense not run
RF025:Slamf6 UTSW 1 171941582 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTAAGCCAAGTGTGAAGTTAATC -3'
(R):5'- CCTGACTTACAAAGACTCATTTTCC -3'

Sequencing Primer
(F):5'- GTTAATCACGACAACCAAAGGTTTGC -3'
(R):5'- CAGCCGAAGTGTTTGCTCTGAATC -3'
Posted On 2021-08-31