Incidental Mutation 'R8934:C5ar1'
ID 680515
Institutional Source Beutler Lab
Gene Symbol C5ar1
Ensembl Gene ENSMUSG00000049130
Gene Name complement component 5a receptor 1
Synonyms C5aR, D7Msu1, Cd88, C5r1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R8934 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16246743-16259540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16248477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 206 (L206Q)
Ref Sequence ENSEMBL: ENSMUSP00000129972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050770] [ENSMUST00000168818] [ENSMUST00000171425] [ENSMUST00000209442]
AlphaFold P30993
Predicted Effect
SMART Domains Protein: ENSMUSP00000060003
Gene: ENSMUSG00000049130
AA Change: L206Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2.2e-5 PFAM
Pfam:7tm_1 54 301 9.4e-41 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168818
AA Change: L206Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129972
Gene: ENSMUSG00000049130
AA Change: L206Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 48 312 2e-5 PFAM
Pfam:7tm_1 54 301 9.2e-52 PFAM
low complexity region 332 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171425
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Homozygous targeted mutants have impaired C5 responses that can show increased or decreased acute inflammation under different circumstances, and thus affect severity of disease or infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Abce1 A G 8: 79,703,032 Y87H probably damaging Het
Adad2 G A 8: 119,614,796 probably benign Het
Adamts12 A G 15: 11,299,929 T901A probably damaging Het
Adamts18 T A 8: 113,736,878 I779F possibly damaging Het
Bod1l T C 5: 41,819,601 T1457A probably benign Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
C4b G A 17: 34,732,984 R1296C possibly damaging Het
Cfap126 A G 1: 171,126,121 T87A probably benign Het
Cnot1 A T 8: 95,765,067 N376K probably benign Het
Cyp3a44 A T 5: 145,794,976 I120K possibly damaging Het
Ddx17 T C 15: 79,536,016 E384G possibly damaging Het
Dnah14 T C 1: 181,622,723 S634P possibly damaging Het
Dusp16 A T 6: 134,741,676 probably benign Het
Eml2 G A 7: 19,179,813 R185H probably damaging Het
Epdr1 T C 13: 19,593,180 E216G possibly damaging Het
Erv3 T C 2: 131,856,181 H86R probably benign Het
Fam69b G A 2: 26,634,854 V89M possibly damaging Het
Gm13119 C T 4: 144,363,775 L462F possibly damaging Het
Gm5114 A G 7: 39,411,129 W99R probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hfe2 T G 3: 96,526,593 C27G probably damaging Het
Ifrd2 T C 9: 107,592,270 probably benign Het
Ikbkb T C 8: 22,660,391 *758W probably null Het
Il1rap T C 16: 26,676,984 C114R probably damaging Het
Irf6 T C 1: 193,162,725 I168T probably benign Het
Kmt2d T C 15: 98,861,886 I1164V unknown Het
Lamb3 T C 1: 193,338,860 L915P probably damaging Het
Lca5 T C 9: 83,391,856 probably benign Het
Lhx3 C A 2: 26,202,246 R211L probably damaging Het
Mettl8 T C 2: 71,051,718 probably benign Het
Mroh1 T C 15: 76,450,186 S1297P probably benign Het
Myh14 T A 7: 44,657,428 T232S probably benign Het
Nemp2 T A 1: 52,649,709 F377L probably damaging Het
Obscn A G 11: 58,998,259 probably null Het
Olfr1272 T A 2: 90,282,012 T188S probably benign Het
Olfr615 T C 7: 103,561,083 V202A probably benign Het
Pgbd5 A C 8: 124,384,259 V231G possibly damaging Het
Pitrm1 T C 13: 6,556,630 L240P probably benign Het
Pkhd1 A G 1: 20,392,010 probably null Het
Ppp2r5a T A 1: 191,368,638 probably benign Het
Prss30 C T 17: 23,973,654 C147Y probably damaging Het
Ptpru C T 4: 131,818,986 V318M probably damaging Het
Rpap1 C T 2: 119,769,249 probably null Het
Rptn A G 3: 93,395,912 Q184R probably benign Het
Rufy1 T A 11: 50,407,878 Q362L probably benign Het
Rundc1 A G 11: 101,431,501 K274E probably damaging Het
Shroom3 T A 5: 92,941,725 I778K probably damaging Het
Slamf6 C T 1: 171,917,771 L22F possibly damaging Het
St7l A G 3: 104,889,318 E249G probably damaging Het
Tmem237 T C 1: 59,114,179 N61S probably benign Het
Tyk2 T C 9: 21,127,120 probably benign Het
Ubtf G T 11: 102,314,029 P115T probably damaging Het
Vmn2r70 T A 7: 85,561,980 I508F possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp663 A T 2: 165,352,794 C502S probably damaging Het
Other mutations in C5ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:C5ar1 UTSW 7 16248939 missense probably damaging 1.00
R1338:C5ar1 UTSW 7 16248335 missense probably damaging 1.00
R1527:C5ar1 UTSW 7 16248193 missense probably damaging 1.00
R4477:C5ar1 UTSW 7 16248864 missense probably damaging 1.00
R4812:C5ar1 UTSW 7 16248333 splice site probably null
R5795:C5ar1 UTSW 7 16248394 missense possibly damaging 0.73
R5963:C5ar1 UTSW 7 16248822 missense possibly damaging 0.60
R6993:C5ar1 UTSW 7 16248912 missense probably damaging 1.00
R7294:C5ar1 UTSW 7 16249025 missense probably benign 0.00
R7464:C5ar1 UTSW 7 16248766 missense probably benign 0.07
R7619:C5ar1 UTSW 7 16248579 missense probably damaging 1.00
R8520:C5ar1 UTSW 7 16248151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGAGTTCAGCTTCTCC -3'
(R):5'- GTTCAAGCCCATCTGGTGTC -3'

Sequencing Primer
(F):5'- TCCACCCTCTTCAAGGTGGG -3'
(R):5'- TCTGGTGTCAGAAGGTCCGC -3'
Posted On 2021-08-31