Incidental Mutation 'R8934:Grid1'
ID680535
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8934 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35321707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 340 (D340N)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
AlphaFold Q61627
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: D340N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D340N

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Abce1 A G 8: 79,703,032 Y87H probably damaging Het
Adamts12 A G 15: 11,299,929 T901A probably damaging Het
Adamts18 T A 8: 113,736,878 I779F possibly damaging Het
Bod1l T C 5: 41,819,601 T1457A probably benign Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
C4b G A 17: 34,732,984 R1296C possibly damaging Het
C5ar1 A T 7: 16,248,477 L206Q probably damaging Het
Cfap126 A G 1: 171,126,121 T87A probably benign Het
Cnot1 A T 8: 95,765,067 N376K probably benign Het
Cyp3a44 A T 5: 145,794,976 I120K possibly damaging Het
Ddx17 T C 15: 79,536,016 E384G possibly damaging Het
Dnah14 T C 1: 181,622,723 S634P possibly damaging Het
Eml2 G A 7: 19,179,813 R185H probably damaging Het
Epdr1 T C 13: 19,593,180 E216G possibly damaging Het
Erv3 T C 2: 131,856,181 H86R probably benign Het
Fam69b G A 2: 26,634,854 V89M possibly damaging Het
Gm13119 C T 4: 144,363,775 L462F possibly damaging Het
Gm5114 A G 7: 39,411,129 W99R probably benign Het
Hfe2 T G 3: 96,526,593 C27G probably damaging Het
Ikbkb T C 8: 22,660,391 *758W probably null Het
Il1rap T C 16: 26,676,984 C114R probably damaging Het
Irf6 T C 1: 193,162,725 I168T probably benign Het
Kmt2d T C 15: 98,861,886 I1164V unknown Het
Lamb3 T C 1: 193,338,860 L915P probably damaging Het
Lca5 T C 9: 83,391,856 probably benign Het
Lhx3 C A 2: 26,202,246 R211L probably damaging Het
Mettl8 T C 2: 71,051,718 probably benign Het
Mroh1 T C 15: 76,450,186 S1297P probably benign Het
Myh14 T A 7: 44,657,428 T232S probably benign Het
Nemp2 T A 1: 52,649,709 F377L probably damaging Het
Obscn A G 11: 58,998,259 probably null Het
Olfr1272 T A 2: 90,282,012 T188S probably benign Het
Olfr615 T C 7: 103,561,083 V202A probably benign Het
Pgbd5 A C 8: 124,384,259 V231G possibly damaging Het
Pitrm1 T C 13: 6,556,630 L240P probably benign Het
Pkhd1 A G 1: 20,392,010 probably null Het
Prss30 C T 17: 23,973,654 C147Y probably damaging Het
Ptpru C T 4: 131,818,986 V318M probably damaging Het
Rpap1 C T 2: 119,769,249 probably null Het
Rptn A G 3: 93,395,912 Q184R probably benign Het
Rufy1 T A 11: 50,407,878 Q362L probably benign Het
Rundc1 A G 11: 101,431,501 K274E probably damaging Het
Shroom3 T A 5: 92,941,725 I778K probably damaging Het
Slamf6 C T 1: 171,917,771 L22F possibly damaging Het
St7l A G 3: 104,889,318 E249G probably damaging Het
Tmem237 T C 1: 59,114,179 N61S probably benign Het
Ubtf G T 11: 102,314,029 P115T probably damaging Het
Vmn2r70 T A 7: 85,561,980 I508F possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp663 A T 2: 165,352,794 C502S probably damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
R8916:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8928:Grid1 UTSW 14 35580766 missense not run
R8935:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8939:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8986:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8993:Grid1 UTSW 14 35026942 missense probably benign 0.00
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGATGAGCTGCTGAAAAC -3'
(R):5'- TTGTACCAACTAAGTGGGAGTGC -3'

Sequencing Primer
(F):5'- CTCACAGGACCAGGAAGATACTGTTG -3'
(R):5'- CAATAATGAGGGCCTTGTCTCCAG -3'
Posted On2021-08-31