Mutagenetix > Incidental Mutation

Incidental Mutation 'R8934:Grid1'

680535

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R8934 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34820108-35583379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 35321707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 340 (D340N)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

probably damaging
Transcript: ENSMUST00000043349
AA Change: D340N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D340N

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	A	14: 32,660,657	S1117L	possibly damaging	Het
Abce1	A	G	8: 79,703,032	Y87H	probably damaging	Het
Adad2	G	A	8: 119,614,796		probably benign	Het
Adamts12	A	G	15: 11,299,929	T901A	probably damaging	Het
Adamts18	T	A	8: 113,736,878	I779F	possibly damaging	Het
Bod1l	T	C	5: 41,819,601	T1457A	probably benign	Het
Brat1	T	C	5: 140,710,249	V125A	probably benign	Het
C4b	G	A	17: 34,732,984	R1296C	possibly damaging	Het
C5ar1	A	T	7: 16,248,477	L206Q	probably damaging	Het
Cfap126	A	G	1: 171,126,121	T87A	probably benign	Het
Cnot1	A	T	8: 95,765,067	N376K	probably benign	Het
Cyp3a44	A	T	5: 145,794,976	I120K	possibly damaging	Het
Ddx17	T	C	15: 79,536,016	E384G	possibly damaging	Het
Dnah14	T	C	1: 181,622,723	S634P	possibly damaging	Het
Dusp16	A	T	6: 134,741,676		probably benign	Het
Eml2	G	A	7: 19,179,813	R185H	probably damaging	Het
Epdr1	T	C	13: 19,593,180	E216G	possibly damaging	Het
Erv3	T	C	2: 131,856,181	H86R	probably benign	Het
Fam69b	G	A	2: 26,634,854	V89M	possibly damaging	Het
Gm13119	C	T	4: 144,363,775	L462F	possibly damaging	Het
Gm5114	A	G	7: 39,411,129	W99R	probably benign	Het
Hfe2	T	G	3: 96,526,593	C27G	probably damaging	Het
Ifrd2	T	C	9: 107,592,270		probably benign	Het
Ikbkb	T	C	8: 22,660,391	*758W	probably null	Het
Il1rap	T	C	16: 26,676,984	C114R	probably damaging	Het
Irf6	T	C	1: 193,162,725	I168T	probably benign	Het
Kmt2d	T	C	15: 98,861,886	I1164V	unknown	Het
Lamb3	T	C	1: 193,338,860	L915P	probably damaging	Het
Lca5	T	C	9: 83,391,856		probably benign	Het
Lhx3	C	A	2: 26,202,246	R211L	probably damaging	Het
Mettl8	T	C	2: 71,051,718		probably benign	Het
Mroh1	T	C	15: 76,450,186	S1297P	probably benign	Het
Myh14	T	A	7: 44,657,428	T232S	probably benign	Het
Nemp2	T	A	1: 52,649,709	F377L	probably damaging	Het
Obscn	A	G	11: 58,998,259		probably null	Het
Olfr1272	T	A	2: 90,282,012	T188S	probably benign	Het
Olfr615	T	C	7: 103,561,083	V202A	probably benign	Het
Pgbd5	A	C	8: 124,384,259	V231G	possibly damaging	Het
Pitrm1	T	C	13: 6,556,630	L240P	probably benign	Het
Pkhd1	A	G	1: 20,392,010		probably null	Het
Ppp2r5a	T	A	1: 191,368,638		probably benign	Het
Prss30	C	T	17: 23,973,654	C147Y	probably damaging	Het
Ptpru	C	T	4: 131,818,986	V318M	probably damaging	Het
Rpap1	C	T	2: 119,769,249		probably null	Het
Rptn	A	G	3: 93,395,912	Q184R	probably benign	Het
Rufy1	T	A	11: 50,407,878	Q362L	probably benign	Het
Rundc1	A	G	11: 101,431,501	K274E	probably damaging	Het
Shroom3	T	A	5: 92,941,725	I778K	probably damaging	Het
Slamf6	C	T	1: 171,917,771	L22F	possibly damaging	Het
St7l	A	G	3: 104,889,318	E249G	probably damaging	Het
Tmem237	T	C	1: 59,114,179	N61S	probably benign	Het
Tyk2	T	C	9: 21,127,120		probably benign	Het
Ubtf	G	T	11: 102,314,029	P115T	probably damaging	Het
Vmn2r70	T	A	7: 85,561,980	I508F	possibly damaging	Het
Zfp609	C	T	9: 65,703,279	A801T	possibly damaging	Het
Zfp663	A	T	2: 165,352,794	C502S	probably damaging	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35445887	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34822639	nonsense	probably null
IGL01643:Grid1	APN	14	35323435	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35309257	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35450370	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35323426	missense	probably benign
IGL02515:Grid1	APN	14	35452345	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34822558	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34945765	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35520685	splice site	probably benign
IGL03296:Grid1	APN	14	35580567	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	35251707	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35309385	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34822690	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34822619	missense	probably benign
R0812:Grid1	UTSW	14	34822619	missense	probably benign
R1144:Grid1	UTSW	14	35562676	splice site	probably benign
R1217:Grid1	UTSW	14	34820229	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34822583	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35309293	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35445965	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35452329	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35446031	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35321807	splice site	probably benign
R2415:Grid1	UTSW	14	35450369	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35562559	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35520727	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35450401	splice site	probably benign
R4364:Grid1	UTSW	14	34946032	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35569557	missense	probably benign
R4694:Grid1	UTSW	14	35026780	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35580687	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34822622	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35321641	missense	probably benign
R5555:Grid1	UTSW	14	35520705	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35323412	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35562547	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35323339	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34820228	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35562513	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35450079	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35321685	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35450302	splice site	probably null
R7913:Grid1	UTSW	14	35569697	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35323359	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35569638	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35580766	missense	probably benign	0.25
R8935:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	35026942	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	35026805	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35323403	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35321707	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35569614	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35580535	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35445857	missense	probably damaging	0.99
R9734:Grid1	UTSW	14	35580785	missense	probably benign
U24488:Grid1	UTSW	14	35580577	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35452294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGGATGAGCTGCTGAAAAC -3'
(R):5'- TTGTACCAACTAAGTGGGAGTGC -3'

Sequencing Primer
(F):5'- CTCACAGGACCAGGAAGATACTGTTG -3'
(R):5'- CAATAATGAGGGCCTTGTCTCCAG -3'

Posted On

2021-08-31