Incidental Mutation 'R8935:Speg'
ID 680545
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 068778-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8935 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75399250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 2232 (K2232N)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087122
AA Change: K2232N

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: K2232N

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik G T 8: 117,698,181 (GRCm39) Q309K probably benign Het
Adam20 T C 8: 41,247,989 (GRCm39) V33A probably benign Het
Ank T C 15: 27,591,112 (GRCm39) V417A probably damaging Het
Arhgef17 C T 7: 100,527,324 (GRCm39) V779I probably benign Het
Atp6v0a1 T A 11: 100,929,519 (GRCm39) F440I possibly damaging Het
Brca2 T G 5: 150,492,446 (GRCm39) S3154A possibly damaging Het
Cdc27 T C 11: 104,398,026 (GRCm39) E778G probably damaging Het
Cep128 C T 12: 91,233,770 (GRCm39) E433K probably damaging Het
Cep192 C T 18: 67,995,543 (GRCm39) T970I probably damaging Het
Chd2 T C 7: 73,153,210 (GRCm39) T249A possibly damaging Het
Cpd C T 11: 76,731,295 (GRCm39) G304S probably damaging Het
Cpsf7 T A 19: 10,509,345 (GRCm39) Y85* probably null Het
Csf3r T A 4: 125,937,200 (GRCm39) S695T probably benign Het
Cyp20a1 A G 1: 60,410,473 (GRCm39) Q258R probably damaging Het
Ddi2 A T 4: 141,412,600 (GRCm39) L104Q probably damaging Het
Dpp8 T C 9: 64,983,066 (GRCm39) S733P possibly damaging Het
Efhd1 A G 1: 87,217,219 (GRCm39) D112G probably damaging Het
Elapor2 C T 5: 9,491,764 (GRCm39) T708M probably damaging Het
Fgfr3 A C 5: 33,892,810 (GRCm39) D752A probably damaging Het
Fmod C A 1: 133,968,586 (GRCm39) H209N probably benign Het
Gde1 C T 7: 118,297,914 (GRCm39) E101K possibly damaging Het
Gldc C T 19: 30,109,093 (GRCm39) R615Q probably benign Het
Gli2 T C 1: 118,764,122 (GRCm39) E1343G probably damaging Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm4847 A G 1: 166,469,789 (GRCm39) Y95H probably damaging Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Gtpbp3 A G 8: 71,945,181 (GRCm39) probably null Het
Haspin A G 11: 73,026,890 (GRCm39) F733S probably damaging Het
Hgh1 C G 15: 76,254,592 (GRCm39) R323G probably damaging Het
Idh1 A T 1: 65,204,378 (GRCm39) I244N probably damaging Het
Idh2 T C 7: 79,764,946 (GRCm39) T27A probably benign Het
Igkv4-69 T C 6: 69,260,912 (GRCm39) T72A possibly damaging Het
Lmntd1 A G 6: 145,489,229 (GRCm39) Y11H probably benign Het
Myt1l T C 12: 29,877,243 (GRCm39) M298T unknown Het
Neb T C 2: 52,141,780 (GRCm39) D3009G probably damaging Het
Nfya A T 17: 48,700,294 (GRCm39) probably benign Het
Nsun2 A G 13: 69,767,586 (GRCm39) D180G probably damaging Het
Or10ag60 A G 2: 87,438,421 (GRCm39) T230A possibly damaging Het
Or4k50-ps1 A T 2: 111,522,244 (GRCm39) Q127L unknown Het
Osbpl6 T C 2: 76,379,800 (GRCm39) V130A possibly damaging Het
Prss44 T A 9: 110,645,527 (GRCm39) I94N probably damaging Het
Rbm6 C T 9: 107,677,945 (GRCm39) V15I probably benign Het
Rdh19 C T 10: 127,685,929 (GRCm39) L14F possibly damaging Het
Rtkn T C 6: 83,115,196 (GRCm39) L14P probably damaging Het
Ryr3 A T 2: 112,508,402 (GRCm39) N3405K probably benign Het
Scp2 T C 4: 107,950,072 (GRCm39) E179G probably damaging Het
Sema3e A T 5: 14,282,127 (GRCm39) K421I probably damaging Het
Sorcs2 C T 5: 36,193,202 (GRCm39) V755M possibly damaging Het
Spef2 T C 15: 9,607,436 (GRCm39) I1328V probably damaging Het
St7l A G 3: 104,778,204 (GRCm39) I114V probably damaging Het
Stkld1 C T 2: 26,833,941 (GRCm39) Q143* probably null Het
Stox2 T C 8: 47,645,895 (GRCm39) T586A possibly damaging Het
Supt20 A G 3: 54,634,988 (GRCm39) probably null Het
Tectb G T 19: 55,183,132 (GRCm39) V338L probably benign Het
Tiam1 T C 16: 89,681,821 (GRCm39) N386D probably damaging Het
Trps1 G A 15: 50,752,344 (GRCm39) Q2* probably null Het
Usp36 C T 11: 118,167,657 (GRCm39) probably null Het
Vmn1r198 C T 13: 22,539,092 (GRCm39) Q104* probably null Het
Vmn1r38 T C 6: 66,753,979 (GRCm39) T46A probably benign Het
Vmn2r110 A G 17: 20,803,957 (GRCm39) V206A probably benign Het
Vmn2r62 T A 7: 42,437,791 (GRCm39) D231V probably benign Het
Zfp143 T C 7: 109,669,736 (GRCm39) L55P probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCCCGTGGCCAGACTT -3'
(R):5'- TTTTCGATGCTGCCGCTGA -3'

Sequencing Primer
(F):5'- AGACTTGGGGCTCGCAG -3'
(R):5'- ACGCGCTTCTCAGAGACTC -3'
Posted On 2021-08-31