Incidental Mutation 'R8935:Sorcs2'
ID 680565
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 068778-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8935 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36193202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 755 (V755M)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: V755M

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: V755M

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik G T 8: 117,698,181 (GRCm39) Q309K probably benign Het
Adam20 T C 8: 41,247,989 (GRCm39) V33A probably benign Het
Ank T C 15: 27,591,112 (GRCm39) V417A probably damaging Het
Arhgef17 C T 7: 100,527,324 (GRCm39) V779I probably benign Het
Atp6v0a1 T A 11: 100,929,519 (GRCm39) F440I possibly damaging Het
Brca2 T G 5: 150,492,446 (GRCm39) S3154A possibly damaging Het
Cdc27 T C 11: 104,398,026 (GRCm39) E778G probably damaging Het
Cep128 C T 12: 91,233,770 (GRCm39) E433K probably damaging Het
Cep192 C T 18: 67,995,543 (GRCm39) T970I probably damaging Het
Chd2 T C 7: 73,153,210 (GRCm39) T249A possibly damaging Het
Cpd C T 11: 76,731,295 (GRCm39) G304S probably damaging Het
Cpsf7 T A 19: 10,509,345 (GRCm39) Y85* probably null Het
Csf3r T A 4: 125,937,200 (GRCm39) S695T probably benign Het
Cyp20a1 A G 1: 60,410,473 (GRCm39) Q258R probably damaging Het
Ddi2 A T 4: 141,412,600 (GRCm39) L104Q probably damaging Het
Dpp8 T C 9: 64,983,066 (GRCm39) S733P possibly damaging Het
Efhd1 A G 1: 87,217,219 (GRCm39) D112G probably damaging Het
Elapor2 C T 5: 9,491,764 (GRCm39) T708M probably damaging Het
Fgfr3 A C 5: 33,892,810 (GRCm39) D752A probably damaging Het
Fmod C A 1: 133,968,586 (GRCm39) H209N probably benign Het
Gde1 C T 7: 118,297,914 (GRCm39) E101K possibly damaging Het
Gldc C T 19: 30,109,093 (GRCm39) R615Q probably benign Het
Gli2 T C 1: 118,764,122 (GRCm39) E1343G probably damaging Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm4847 A G 1: 166,469,789 (GRCm39) Y95H probably damaging Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Gtpbp3 A G 8: 71,945,181 (GRCm39) probably null Het
Haspin A G 11: 73,026,890 (GRCm39) F733S probably damaging Het
Hgh1 C G 15: 76,254,592 (GRCm39) R323G probably damaging Het
Idh1 A T 1: 65,204,378 (GRCm39) I244N probably damaging Het
Idh2 T C 7: 79,764,946 (GRCm39) T27A probably benign Het
Igkv4-69 T C 6: 69,260,912 (GRCm39) T72A possibly damaging Het
Lmntd1 A G 6: 145,489,229 (GRCm39) Y11H probably benign Het
Myt1l T C 12: 29,877,243 (GRCm39) M298T unknown Het
Neb T C 2: 52,141,780 (GRCm39) D3009G probably damaging Het
Nfya A T 17: 48,700,294 (GRCm39) probably benign Het
Nsun2 A G 13: 69,767,586 (GRCm39) D180G probably damaging Het
Or10ag60 A G 2: 87,438,421 (GRCm39) T230A possibly damaging Het
Or4k50-ps1 A T 2: 111,522,244 (GRCm39) Q127L unknown Het
Osbpl6 T C 2: 76,379,800 (GRCm39) V130A possibly damaging Het
Prss44 T A 9: 110,645,527 (GRCm39) I94N probably damaging Het
Rbm6 C T 9: 107,677,945 (GRCm39) V15I probably benign Het
Rdh19 C T 10: 127,685,929 (GRCm39) L14F possibly damaging Het
Rtkn T C 6: 83,115,196 (GRCm39) L14P probably damaging Het
Ryr3 A T 2: 112,508,402 (GRCm39) N3405K probably benign Het
Scp2 T C 4: 107,950,072 (GRCm39) E179G probably damaging Het
Sema3e A T 5: 14,282,127 (GRCm39) K421I probably damaging Het
Spef2 T C 15: 9,607,436 (GRCm39) I1328V probably damaging Het
Speg A T 1: 75,399,250 (GRCm39) K2232N probably benign Het
St7l A G 3: 104,778,204 (GRCm39) I114V probably damaging Het
Stkld1 C T 2: 26,833,941 (GRCm39) Q143* probably null Het
Stox2 T C 8: 47,645,895 (GRCm39) T586A possibly damaging Het
Supt20 A G 3: 54,634,988 (GRCm39) probably null Het
Tectb G T 19: 55,183,132 (GRCm39) V338L probably benign Het
Tiam1 T C 16: 89,681,821 (GRCm39) N386D probably damaging Het
Trps1 G A 15: 50,752,344 (GRCm39) Q2* probably null Het
Usp36 C T 11: 118,167,657 (GRCm39) probably null Het
Vmn1r198 C T 13: 22,539,092 (GRCm39) Q104* probably null Het
Vmn1r38 T C 6: 66,753,979 (GRCm39) T46A probably benign Het
Vmn2r110 A G 17: 20,803,957 (GRCm39) V206A probably benign Het
Vmn2r62 T A 7: 42,437,791 (GRCm39) D231V probably benign Het
Zfp143 T C 7: 109,669,736 (GRCm39) L55P probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGAAACTGCCTGTCAG -3'
(R):5'- GCTTCAGCTCTCCAAAGCAGAC -3'

Sequencing Primer
(F):5'- TGTCAGTGCCAGTCCAGGAC -3'
(R):5'- AGCACAGCCCATCTCTCCATTC -3'
Posted On 2021-08-31