Incidental Mutation 'R8936:Vmn1r31'
ID 680636
Institutional Source Beutler Lab
Gene Symbol Vmn1r31
Ensembl Gene ENSMUSG00000115404
Gene Name vomeronasal 1 receptor 31
Synonyms Gm6709
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8936 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58470941-58475330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58472098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 261 (I261F)
Ref Sequence ENSEMBL: ENSMUSP00000153749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176023] [ENSMUST00000176147] [ENSMUST00000177318] [ENSMUST00000226390] [ENSMUST00000228586]
AlphaFold H3BKW5
Predicted Effect unknown
Transcript: ENSMUST00000176023
AA Change: I212F
SMART Domains Protein: ENSMUSP00000135252
Gene: ENSMUSG00000115404
AA Change: I212F

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176147
AA Change: I212F
SMART Domains Protein: ENSMUSP00000135282
Gene: ENSMUSG00000115404
AA Change: I212F

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177318
AA Change: I261F
SMART Domains Protein: ENSMUSP00000135555
Gene: ENSMUSG00000115404
AA Change: I261F

DomainStartEndE-ValueType
Pfam:V1R 28 107 1.9e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226390
AA Change: I261F
Predicted Effect unknown
Transcript: ENSMUST00000228586
AA Change: I261F
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G A 14: 49,770,567 T483I probably damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abcc2 A G 19: 43,808,662 K491E probably benign Het
Abcd3 T C 3: 121,775,468 I374V probably benign Het
Adam34 G A 8: 43,651,402 T402I probably benign Het
Angptl7 G T 4: 148,497,333 H199N probably benign Het
Ankrd11 A G 8: 122,895,101 C671R possibly damaging Het
Anxa7 G A 14: 20,471,427 P67L unknown Het
Ap3d1 T A 10: 80,712,118 Q913H probably benign Het
Arhgef37 A G 18: 61,523,877 I39T probably damaging Het
BC049762 A G 11: 51,254,422 S113P probably damaging Het
C3ar1 T A 6: 122,851,085 T58S probably damaging Het
Caap1 A T 4: 94,501,095 L334Q probably damaging Het
Ccr1 A T 9: 123,963,845 I216K probably damaging Het
Cdh9 T A 15: 16,831,076 probably null Het
Cept1 A G 3: 106,504,605 F351S possibly damaging Het
Cfap61 A G 2: 145,949,959 D112G possibly damaging Het
Cul9 T A 17: 46,528,602 S817C possibly damaging Het
Dido1 A G 2: 180,661,402 S1570P probably benign Het
Disc1 A G 8: 125,088,015 D206G probably damaging Het
Dock5 T A 14: 67,845,990 R157* probably null Het
Dpp6 A G 5: 27,721,142 D738G probably damaging Het
Enpep A G 3: 129,332,235 F83L possibly damaging Het
F10 G T 8: 13,045,086 W81L probably damaging Het
Fam129c T A 8: 71,607,663 probably benign Het
Fam217a T C 13: 34,911,164 D356G probably damaging Het
Fes T C 7: 80,381,725 E467G probably damaging Het
Fignl2 A T 15: 101,053,458 D314E unknown Het
Foxh1 T C 15: 76,668,519 probably benign Het
Gdpd5 T C 7: 99,459,992 L573P probably benign Het
Gigyf1 T A 5: 137,525,207 S934T probably damaging Het
Gm7356 C T 17: 14,001,675 V31I probably benign Het
Hoxa2 C A 6: 52,163,537 K156N probably damaging Het
Ifi203 G A 1: 173,929,291 probably benign Het
Il5ra A T 6: 106,715,643 D380E possibly damaging Het
Ino80c C A 18: 24,121,808 probably benign Het
Kif18a T A 2: 109,333,621 W772R probably benign Het
Lipo3 G T 19: 33,580,480 Q171K probably damaging Het
Mga A T 2: 119,964,228 T2798S probably damaging Het
Mybpc1 T A 10: 88,558,575 T297S probably benign Het
Myh7 T G 14: 54,990,983 Q222P probably benign Het
N4bp2l2 T C 5: 150,661,897 D206G probably benign Het
Nacc2 G C 2: 26,062,204 T380S probably benign Het
Nkpd1 T A 7: 19,521,950 D186E probably damaging Het
Nol10 A T 12: 17,416,862 E581V probably benign Het
Ntrk1 A T 3: 87,786,059 N255K possibly damaging Het
Nudt5 T G 2: 5,864,417 D151E probably benign Het
Obscn A T 11: 59,002,032 L6796Q probably benign Het
Olfr730 A G 14: 50,186,542 I225T possibly damaging Het
Olfr763 C T 10: 129,011,933 A216V probably benign Het
Oxct2b A G 4: 123,117,045 T253A probably benign Het
Patl1 G A 19: 11,914,361 C10Y probably damaging Het
Pikfyve A G 1: 65,271,268 R1905G possibly damaging Het
Pkhd1l1 A G 15: 44,538,916 E2228G possibly damaging Het
Plcg1 A G 2: 160,748,066 K135E probably benign Het
Proz A G 8: 13,065,319 T112A probably benign Het
Prune2 A G 19: 17,121,835 N1568D probably benign Het
Rbm4 A G 19: 4,787,511 V431A probably benign Het
Rgs19 G T 2: 181,691,265 C40* probably null Het
Rimbp3 T A 16: 17,213,020 I1436K probably benign Het
Rnps1 T A 17: 24,422,202 M192K probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Slc17a9 G A 2: 180,738,417 V318I probably benign Het
Slc5a12 A G 2: 110,637,110 I412V probably damaging Het
Smc4 T A 3: 69,018,158 N329K probably benign Het
St3gal4 G A 9: 35,053,427 R165W probably damaging Het
Strbp G A 2: 37,603,937 R375* probably null Het
Tacc2 A G 7: 130,626,637 N1684S possibly damaging Het
Tet1 A T 10: 62,840,284 L671* probably null Het
Tex2 C A 11: 106,567,318 E429* probably null Het
Tgm4 T C 9: 123,040,476 I40T possibly damaging Het
Tmem132d C T 5: 127,792,612 D553N probably damaging Het
Tnks A T 8: 34,853,347 Y723* probably null Het
Tnks1bp1 A T 2: 85,063,976 T1416S probably benign Het
Tnxb T A 17: 34,685,672 L1137Q probably damaging Het
Tor4a A C 2: 25,195,190 C68G probably damaging Het
Tubb2b A C 13: 34,128,462 V116G probably damaging Het
Upb1 T A 10: 75,414,993 S99T probably benign Het
Vmn1r53 T C 6: 90,223,589 Y251C probably benign Het
Vmn2r58 T C 7: 41,864,557 R221G Het
Vmn2r88 A T 14: 51,418,526 I740F possibly damaging Het
Zfp644 C T 5: 106,635,637 G1015R probably damaging Het
Zfy1 T C Y: 738,726 D160G unknown Het
Zscan25 T A 5: 145,286,390 V156E probably damaging Het
Zyg11b A T 4: 108,252,159 F443I Het
Other mutations in Vmn1r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Vmn1r31 APN 6 58472799 missense probably benign 0.06
IGL01386:Vmn1r31 APN 6 58472602 missense probably benign 0.22
IGL01785:Vmn1r31 APN 6 58472724 missense possibly damaging 0.95
IGL02527:Vmn1r31 APN 6 58472793 missense probably benign 0.01
PIT4791001:Vmn1r31 UTSW 6 58472043 missense probably damaging 0.97
R0107:Vmn1r31 UTSW 6 58472743 missense probably benign 0.05
R1250:Vmn1r31 UTSW 6 58472658 missense probably benign 0.01
R1616:Vmn1r31 UTSW 6 58472058 missense probably damaging 0.97
R1883:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R1884:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R2942:Vmn1r31 UTSW 6 58472598 missense possibly damaging 0.87
R4589:Vmn1r31 UTSW 6 58472611 missense probably damaging 1.00
R4672:Vmn1r31 UTSW 6 58472071 missense probably damaging 0.97
R4676:Vmn1r31 UTSW 6 58472013 missense probably damaging 0.97
R4702:Vmn1r31 UTSW 6 58471968 makesense probably null
R4703:Vmn1r31 UTSW 6 58471968 makesense probably null
R4705:Vmn1r31 UTSW 6 58471968 makesense probably null
R6341:Vmn1r31 UTSW 6 58472010 missense probably benign 0.35
R6549:Vmn1r31 UTSW 6 58472663 missense possibly damaging 0.92
R7238:Vmn1r31 UTSW 6 58472873 missense
R7609:Vmn1r31 UTSW 6 58472470 missense probably damaging 0.97
R8438:Vmn1r31 UTSW 6 58472661 missense
R9103:Vmn1r31 UTSW 6 58472088 missense unknown
Z1176:Vmn1r31 UTSW 6 58472391 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCTGTGGGTAGCAGGAATAC -3'
(R):5'- TCAGAGGCAATGCAAGCAC -3'

Sequencing Primer
(F):5'- TATATGCTGGCACAACACTCACATG -3'
(R):5'- GAGGCAATGCAAGCACCTTCATAG -3'
Posted On 2021-08-31