Mutagenetix > Incidental Mutations

Incidental Mutation 'R8936:Tnks'

680647

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8936 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 34853347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 723 (Y723*)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000033929
AA Change: Y723*

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: Y723*

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	G	A	14: 49,770,567	T483I	probably damaging	Het
4833427G06Rik	A	G	9: 51,099,998		probably null	Het
Abcc2	A	G	19: 43,808,662	K491E	probably benign	Het
Abcd3	T	C	3: 121,775,468	I374V	probably benign	Het
Adam34	G	A	8: 43,651,402	T402I	probably benign	Het
Angptl7	G	T	4: 148,497,333	H199N	probably benign	Het
Ankrd11	A	G	8: 122,895,101	C671R	possibly damaging	Het
Anxa7	G	A	14: 20,471,427	P67L	unknown	Het
Ap3d1	T	A	10: 80,712,118	Q913H	probably benign	Het
Arhgef37	A	G	18: 61,523,877	I39T	probably damaging	Het
BC049762	A	G	11: 51,254,422	S113P	probably damaging	Het
C3ar1	T	A	6: 122,851,085	T58S	probably damaging	Het
Caap1	A	T	4: 94,501,095	L334Q	probably damaging	Het
Ccr1	A	T	9: 123,963,845	I216K	probably damaging	Het
Cdh9	T	A	15: 16,831,076		probably null	Het
Cept1	A	G	3: 106,504,605	F351S	possibly damaging	Het
Cfap61	A	G	2: 145,949,959	D112G	possibly damaging	Het
Cul9	T	A	17: 46,528,602	S817C	possibly damaging	Het
Dido1	A	G	2: 180,661,402	S1570P	probably benign	Het
Disc1	A	G	8: 125,088,015	D206G	probably damaging	Het
Dock5	T	A	14: 67,845,990	R157*	probably null	Het
Dpp6	A	G	5: 27,721,142	D738G	probably damaging	Het
Enpep	A	G	3: 129,332,235	F83L	possibly damaging	Het
F10	G	T	8: 13,045,086	W81L	probably damaging	Het
Fam129c	T	A	8: 71,607,663		probably benign	Het
Fam217a	T	C	13: 34,911,164	D356G	probably damaging	Het
Fes	T	C	7: 80,381,725	E467G	probably damaging	Het
Fignl2	A	T	15: 101,053,458	D314E	unknown	Het
Foxh1	T	C	15: 76,668,519		probably benign	Het
Gdpd5	T	C	7: 99,459,992	L573P	probably benign	Het
Gigyf1	T	A	5: 137,525,207	S934T	probably damaging	Het
Gm7356	C	T	17: 14,001,675	V31I	probably benign	Het
Hoxa2	C	A	6: 52,163,537	K156N	probably damaging	Het
Ifi203	G	A	1: 173,929,291		probably benign	Het
Il5ra	A	T	6: 106,715,643	D380E	possibly damaging	Het
Ino80c	C	A	18: 24,121,808		probably benign	Het
Kif18a	T	A	2: 109,333,621	W772R	probably benign	Het
Lipo3	G	T	19: 33,580,480	Q171K	probably damaging	Het
Mga	A	T	2: 119,964,228	T2798S	probably damaging	Het
Mybpc1	T	A	10: 88,558,575	T297S	probably benign	Het
Myh7	T	G	14: 54,990,983	Q222P	probably benign	Het
N4bp2l2	T	C	5: 150,661,897	D206G	probably benign	Het
Nacc2	G	C	2: 26,062,204	T380S	probably benign	Het
Nkpd1	T	A	7: 19,521,950	D186E	probably damaging	Het
Nol10	A	T	12: 17,416,862	E581V	probably benign	Het
Ntrk1	A	T	3: 87,786,059	N255K	possibly damaging	Het
Nudt5	T	G	2: 5,864,417	D151E	probably benign	Het
Obscn	A	T	11: 59,002,032	L6796Q	probably benign	Het
Olfr730	A	G	14: 50,186,542	I225T	possibly damaging	Het
Olfr763	C	T	10: 129,011,933	A216V	probably benign	Het
Oxct2b	A	G	4: 123,117,045	T253A	probably benign	Het
Patl1	G	A	19: 11,914,361	C10Y	probably damaging	Het
Pikfyve	A	G	1: 65,271,268	R1905G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,538,916	E2228G	possibly damaging	Het
Plcg1	A	G	2: 160,748,066	K135E	probably benign	Het
Proz	A	G	8: 13,065,319	T112A	probably benign	Het
Prune2	A	G	19: 17,121,835	N1568D	probably benign	Het
Rbm4	A	G	19: 4,787,511	V431A	probably benign	Het
Rgs19	G	T	2: 181,691,265	C40*	probably null	Het
Rimbp3	T	A	16: 17,213,020	I1436K	probably benign	Het
Rnps1	T	A	17: 24,422,202	M192K	probably damaging	Het
Rrad	C	T	8: 104,628,590	R262Q	possibly damaging	Het
Slc17a9	G	A	2: 180,738,417	V318I	probably benign	Het
Slc5a12	A	G	2: 110,637,110	I412V	probably damaging	Het
Smc4	T	A	3: 69,018,158	N329K	probably benign	Het
St3gal4	G	A	9: 35,053,427	R165W	probably damaging	Het
Strbp	G	A	2: 37,603,937	R375*	probably null	Het
Tacc2	A	G	7: 130,626,637	N1684S	possibly damaging	Het
Tet1	A	T	10: 62,840,284	L671*	probably null	Het
Tex2	C	A	11: 106,567,318	E429*	probably null	Het
Tgm4	T	C	9: 123,040,476	I40T	possibly damaging	Het
Tmem132d	C	T	5: 127,792,612	D553N	probably damaging	Het
Tnks1bp1	A	T	2: 85,063,976	T1416S	probably benign	Het
Tnxb	T	A	17: 34,685,672	L1137Q	probably damaging	Het
Tor4a	A	C	2: 25,195,190	C68G	probably damaging	Het
Tubb2b	A	C	13: 34,128,462	V116G	probably damaging	Het
Upb1	T	A	10: 75,414,993	S99T	probably benign	Het
Vmn1r31	T	A	6: 58,472,098	I261F	unknown	Het
Vmn1r53	T	C	6: 90,223,589	Y251C	probably benign	Het
Vmn2r58	T	C	7: 41,864,557	R221G		Het
Vmn2r88	A	T	14: 51,418,526	I740F	possibly damaging	Het
Zfp644	C	T	5: 106,635,637	G1015R	probably damaging	Het
Zfy1	T	C	Y: 738,726	D160G	unknown	Het
Zscan25	T	A	5: 145,286,390	V156E	probably damaging	Het
Zyg11b	A	T	4: 108,252,159	F443I		Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GATAGCCCTCTTAGCACTTGTAG -3'
(R):5'- TGGGGCAGAGTCTCACATAG -3'

Sequencing Primer
(F):5'- AGCCCTCTTAGCACTTGTAGATTAC -3'
(R):5'- ACATAGGCTGTGCTGGCTG -3'

Posted On

2021-08-31