Incidental Mutation 'R8936:Tnks'
ID 680647
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8936 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 34853347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 723 (Y723*)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033929
AA Change: Y723*
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: Y723*

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G A 14: 49,770,567 T483I probably damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abcc2 A G 19: 43,808,662 K491E probably benign Het
Abcd3 T C 3: 121,775,468 I374V probably benign Het
Adam34 G A 8: 43,651,402 T402I probably benign Het
Angptl7 G T 4: 148,497,333 H199N probably benign Het
Ankrd11 A G 8: 122,895,101 C671R possibly damaging Het
Anxa7 G A 14: 20,471,427 P67L unknown Het
Ap3d1 T A 10: 80,712,118 Q913H probably benign Het
Arhgef37 A G 18: 61,523,877 I39T probably damaging Het
BC049762 A G 11: 51,254,422 S113P probably damaging Het
C3ar1 T A 6: 122,851,085 T58S probably damaging Het
Caap1 A T 4: 94,501,095 L334Q probably damaging Het
Ccr1 A T 9: 123,963,845 I216K probably damaging Het
Cdh9 T A 15: 16,831,076 probably null Het
Cept1 A G 3: 106,504,605 F351S possibly damaging Het
Cfap61 A G 2: 145,949,959 D112G possibly damaging Het
Cul9 T A 17: 46,528,602 S817C possibly damaging Het
Dido1 A G 2: 180,661,402 S1570P probably benign Het
Disc1 A G 8: 125,088,015 D206G probably damaging Het
Dock5 T A 14: 67,845,990 R157* probably null Het
Dpp6 A G 5: 27,721,142 D738G probably damaging Het
Enpep A G 3: 129,332,235 F83L possibly damaging Het
F10 G T 8: 13,045,086 W81L probably damaging Het
Fam129c T A 8: 71,607,663 probably benign Het
Fam217a T C 13: 34,911,164 D356G probably damaging Het
Fes T C 7: 80,381,725 E467G probably damaging Het
Fignl2 A T 15: 101,053,458 D314E unknown Het
Foxh1 T C 15: 76,668,519 probably benign Het
Gdpd5 T C 7: 99,459,992 L573P probably benign Het
Gigyf1 T A 5: 137,525,207 S934T probably damaging Het
Gm7356 C T 17: 14,001,675 V31I probably benign Het
Hoxa2 C A 6: 52,163,537 K156N probably damaging Het
Ifi203 G A 1: 173,929,291 probably benign Het
Il5ra A T 6: 106,715,643 D380E possibly damaging Het
Ino80c C A 18: 24,121,808 probably benign Het
Kif18a T A 2: 109,333,621 W772R probably benign Het
Lipo3 G T 19: 33,580,480 Q171K probably damaging Het
Mga A T 2: 119,964,228 T2798S probably damaging Het
Mybpc1 T A 10: 88,558,575 T297S probably benign Het
Myh7 T G 14: 54,990,983 Q222P probably benign Het
N4bp2l2 T C 5: 150,661,897 D206G probably benign Het
Nacc2 G C 2: 26,062,204 T380S probably benign Het
Nkpd1 T A 7: 19,521,950 D186E probably damaging Het
Nol10 A T 12: 17,416,862 E581V probably benign Het
Ntrk1 A T 3: 87,786,059 N255K possibly damaging Het
Nudt5 T G 2: 5,864,417 D151E probably benign Het
Obscn A T 11: 59,002,032 L6796Q probably benign Het
Olfr730 A G 14: 50,186,542 I225T possibly damaging Het
Olfr763 C T 10: 129,011,933 A216V probably benign Het
Oxct2b A G 4: 123,117,045 T253A probably benign Het
Patl1 G A 19: 11,914,361 C10Y probably damaging Het
Pikfyve A G 1: 65,271,268 R1905G possibly damaging Het
Pkhd1l1 A G 15: 44,538,916 E2228G possibly damaging Het
Plcg1 A G 2: 160,748,066 K135E probably benign Het
Proz A G 8: 13,065,319 T112A probably benign Het
Prune2 A G 19: 17,121,835 N1568D probably benign Het
Rbm4 A G 19: 4,787,511 V431A probably benign Het
Rgs19 G T 2: 181,691,265 C40* probably null Het
Rimbp3 T A 16: 17,213,020 I1436K probably benign Het
Rnps1 T A 17: 24,422,202 M192K probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Slc17a9 G A 2: 180,738,417 V318I probably benign Het
Slc5a12 A G 2: 110,637,110 I412V probably damaging Het
Smc4 T A 3: 69,018,158 N329K probably benign Het
St3gal4 G A 9: 35,053,427 R165W probably damaging Het
Strbp G A 2: 37,603,937 R375* probably null Het
Tacc2 A G 7: 130,626,637 N1684S possibly damaging Het
Tet1 A T 10: 62,840,284 L671* probably null Het
Tex2 C A 11: 106,567,318 E429* probably null Het
Tgm4 T C 9: 123,040,476 I40T possibly damaging Het
Tmem132d C T 5: 127,792,612 D553N probably damaging Het
Tnks1bp1 A T 2: 85,063,976 T1416S probably benign Het
Tnxb T A 17: 34,685,672 L1137Q probably damaging Het
Tor4a A C 2: 25,195,190 C68G probably damaging Het
Tubb2b A C 13: 34,128,462 V116G probably damaging Het
Upb1 T A 10: 75,414,993 S99T probably benign Het
Vmn1r31 T A 6: 58,472,098 I261F unknown Het
Vmn1r53 T C 6: 90,223,589 Y251C probably benign Het
Vmn2r58 T C 7: 41,864,557 R221G Het
Vmn2r88 A T 14: 51,418,526 I740F possibly damaging Het
Zfp644 C T 5: 106,635,637 G1015R probably damaging Het
Zfy1 T C Y: 738,726 D160G unknown Het
Zscan25 T A 5: 145,286,390 V156E probably damaging Het
Zyg11b A T 4: 108,252,159 F443I Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8870:Tnks UTSW 8 34847279 critical splice donor site probably null
R9049:Tnks UTSW 8 34841778 missense probably damaging 0.96
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GATAGCCCTCTTAGCACTTGTAG -3'
(R):5'- TGGGGCAGAGTCTCACATAG -3'

Sequencing Primer
(F):5'- AGCCCTCTTAGCACTTGTAGATTAC -3'
(R):5'- ACATAGGCTGTGCTGGCTG -3'
Posted On 2021-08-31