Incidental Mutation 'R8936:Foxh1'
ID 680676
Institutional Source Beutler Lab
Gene Symbol Foxh1
Ensembl Gene ENSMUSG00000033837
Gene Name forkhead box H1
Synonyms Fast2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8936 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 76668225-76669948 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 76668519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000037551] [ENSMUST00000037824] [ENSMUST00000135388] [ENSMUST00000230451] [ENSMUST00000230964]
AlphaFold O88621
Predicted Effect probably benign
Transcript: ENSMUST00000004294
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000036591
Gene: ENSMUSG00000033837
AA Change: T332A

DomainStartEndE-ValueType
FH 62 152 2.71e-34 SMART
low complexity region 183 194 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect probably benign
Transcript: ENSMUST00000230451
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional knockout of this gene in the lateral plate mesoderm results in death within a few days after birth. Mutant animals exhibit right isomerism affecting the heart, lungs, and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G A 14: 49,770,567 T483I probably damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abcc2 A G 19: 43,808,662 K491E probably benign Het
Abcd3 T C 3: 121,775,468 I374V probably benign Het
Adam34 G A 8: 43,651,402 T402I probably benign Het
Angptl7 G T 4: 148,497,333 H199N probably benign Het
Ankrd11 A G 8: 122,895,101 C671R possibly damaging Het
Anxa7 G A 14: 20,471,427 P67L unknown Het
Ap3d1 T A 10: 80,712,118 Q913H probably benign Het
Arhgef37 A G 18: 61,523,877 I39T probably damaging Het
BC049762 A G 11: 51,254,422 S113P probably damaging Het
C3ar1 T A 6: 122,851,085 T58S probably damaging Het
Caap1 A T 4: 94,501,095 L334Q probably damaging Het
Ccr1 A T 9: 123,963,845 I216K probably damaging Het
Cdh9 T A 15: 16,831,076 probably null Het
Cept1 A G 3: 106,504,605 F351S possibly damaging Het
Cfap61 A G 2: 145,949,959 D112G possibly damaging Het
Cul9 T A 17: 46,528,602 S817C possibly damaging Het
Dido1 A G 2: 180,661,402 S1570P probably benign Het
Disc1 A G 8: 125,088,015 D206G probably damaging Het
Dock5 T A 14: 67,845,990 R157* probably null Het
Dpp6 A G 5: 27,721,142 D738G probably damaging Het
Enpep A G 3: 129,332,235 F83L possibly damaging Het
F10 G T 8: 13,045,086 W81L probably damaging Het
Fam129c T A 8: 71,607,663 probably benign Het
Fam217a T C 13: 34,911,164 D356G probably damaging Het
Fes T C 7: 80,381,725 E467G probably damaging Het
Fignl2 A T 15: 101,053,458 D314E unknown Het
Gdpd5 T C 7: 99,459,992 L573P probably benign Het
Gigyf1 T A 5: 137,525,207 S934T probably damaging Het
Gm7356 C T 17: 14,001,675 V31I probably benign Het
Hoxa2 C A 6: 52,163,537 K156N probably damaging Het
Ifi203 G A 1: 173,929,291 probably benign Het
Il5ra A T 6: 106,715,643 D380E possibly damaging Het
Ino80c C A 18: 24,121,808 probably benign Het
Kif18a T A 2: 109,333,621 W772R probably benign Het
Lipo3 G T 19: 33,580,480 Q171K probably damaging Het
Mga A T 2: 119,964,228 T2798S probably damaging Het
Mybpc1 T A 10: 88,558,575 T297S probably benign Het
Myh7 T G 14: 54,990,983 Q222P probably benign Het
N4bp2l2 T C 5: 150,661,897 D206G probably benign Het
Nacc2 G C 2: 26,062,204 T380S probably benign Het
Nkpd1 T A 7: 19,521,950 D186E probably damaging Het
Nol10 A T 12: 17,416,862 E581V probably benign Het
Ntrk1 A T 3: 87,786,059 N255K possibly damaging Het
Nudt5 T G 2: 5,864,417 D151E probably benign Het
Obscn A T 11: 59,002,032 L6796Q probably benign Het
Olfr730 A G 14: 50,186,542 I225T possibly damaging Het
Olfr763 C T 10: 129,011,933 A216V probably benign Het
Oxct2b A G 4: 123,117,045 T253A probably benign Het
Patl1 G A 19: 11,914,361 C10Y probably damaging Het
Pikfyve A G 1: 65,271,268 R1905G possibly damaging Het
Pkhd1l1 A G 15: 44,538,916 E2228G possibly damaging Het
Plcg1 A G 2: 160,748,066 K135E probably benign Het
Proz A G 8: 13,065,319 T112A probably benign Het
Prune2 A G 19: 17,121,835 N1568D probably benign Het
Rbm4 A G 19: 4,787,511 V431A probably benign Het
Rgs19 G T 2: 181,691,265 C40* probably null Het
Rimbp3 T A 16: 17,213,020 I1436K probably benign Het
Rnps1 T A 17: 24,422,202 M192K probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Slc17a9 G A 2: 180,738,417 V318I probably benign Het
Slc5a12 A G 2: 110,637,110 I412V probably damaging Het
Smc4 T A 3: 69,018,158 N329K probably benign Het
St3gal4 G A 9: 35,053,427 R165W probably damaging Het
Strbp G A 2: 37,603,937 R375* probably null Het
Tacc2 A G 7: 130,626,637 N1684S possibly damaging Het
Tet1 A T 10: 62,840,284 L671* probably null Het
Tex2 C A 11: 106,567,318 E429* probably null Het
Tgm4 T C 9: 123,040,476 I40T possibly damaging Het
Tmem132d C T 5: 127,792,612 D553N probably damaging Het
Tnks A T 8: 34,853,347 Y723* probably null Het
Tnks1bp1 A T 2: 85,063,976 T1416S probably benign Het
Tnxb T A 17: 34,685,672 L1137Q probably damaging Het
Tor4a A C 2: 25,195,190 C68G probably damaging Het
Tubb2b A C 13: 34,128,462 V116G probably damaging Het
Upb1 T A 10: 75,414,993 S99T probably benign Het
Vmn1r31 T A 6: 58,472,098 I261F unknown Het
Vmn1r53 T C 6: 90,223,589 Y251C probably benign Het
Vmn2r58 T C 7: 41,864,557 R221G Het
Vmn2r88 A T 14: 51,418,526 I740F possibly damaging Het
Zfp644 C T 5: 106,635,637 G1015R probably damaging Het
Zfy1 T C Y: 738,726 D160G unknown Het
Zscan25 T A 5: 145,286,390 V156E probably damaging Het
Zyg11b A T 4: 108,252,159 F443I Het
Other mutations in Foxh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Foxh1 APN 15 76668920 missense probably damaging 1.00
R0112:Foxh1 UTSW 15 76669010 missense probably benign 0.00
R0126:Foxh1 UTSW 15 76669254 missense probably damaging 1.00
R2266:Foxh1 UTSW 15 76668620 missense probably benign 0.00
R5223:Foxh1 UTSW 15 76668729 splice site probably null
R5775:Foxh1 UTSW 15 76669849 missense probably benign 0.44
R6666:Foxh1 UTSW 15 76668413 missense probably damaging 1.00
R7528:Foxh1 UTSW 15 76669311 missense probably benign 0.03
R8095:Foxh1 UTSW 15 76669008 nonsense probably null
R9287:Foxh1 UTSW 15 76668926 missense probably damaging 0.99
R9429:Foxh1 UTSW 15 76669242 missense probably null 0.16
Z1177:Foxh1 UTSW 15 76669021 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTACATGCTGTACCAGGAAAGG -3'
(R):5'- GGAGGTAATCAGGCCTTCTC -3'

Sequencing Primer
(F):5'- CTGTACCAGGAAAGGAGCCAGC -3'
(R):5'- GGTAATCAGGCCTTCTCCCGTC -3'
Posted On 2021-08-31