Incidental Mutation 'R8936:Abcc2'
ID 680689
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8936 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43808662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 491 (K491E)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: K491E

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: K491E

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G A 14: 49,770,567 T483I probably damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abcd3 T C 3: 121,775,468 I374V probably benign Het
Adam34 G A 8: 43,651,402 T402I probably benign Het
Angptl7 G T 4: 148,497,333 H199N probably benign Het
Ankrd11 A G 8: 122,895,101 C671R possibly damaging Het
Anxa7 G A 14: 20,471,427 P67L unknown Het
Ap3d1 T A 10: 80,712,118 Q913H probably benign Het
Arhgef37 A G 18: 61,523,877 I39T probably damaging Het
BC049762 A G 11: 51,254,422 S113P probably damaging Het
C3ar1 T A 6: 122,851,085 T58S probably damaging Het
Caap1 A T 4: 94,501,095 L334Q probably damaging Het
Ccr1 A T 9: 123,963,845 I216K probably damaging Het
Cdh9 T A 15: 16,831,076 probably null Het
Cept1 A G 3: 106,504,605 F351S possibly damaging Het
Cfap61 A G 2: 145,949,959 D112G possibly damaging Het
Cul9 T A 17: 46,528,602 S817C possibly damaging Het
Dido1 A G 2: 180,661,402 S1570P probably benign Het
Disc1 A G 8: 125,088,015 D206G probably damaging Het
Dock5 T A 14: 67,845,990 R157* probably null Het
Dpp6 A G 5: 27,721,142 D738G probably damaging Het
Enpep A G 3: 129,332,235 F83L possibly damaging Het
F10 G T 8: 13,045,086 W81L probably damaging Het
Fam129c T A 8: 71,607,663 probably benign Het
Fam217a T C 13: 34,911,164 D356G probably damaging Het
Fes T C 7: 80,381,725 E467G probably damaging Het
Fignl2 A T 15: 101,053,458 D314E unknown Het
Foxh1 T C 15: 76,668,519 probably benign Het
Gdpd5 T C 7: 99,459,992 L573P probably benign Het
Gigyf1 T A 5: 137,525,207 S934T probably damaging Het
Gm7356 C T 17: 14,001,675 V31I probably benign Het
Hoxa2 C A 6: 52,163,537 K156N probably damaging Het
Ifi203 G A 1: 173,929,291 probably benign Het
Il5ra A T 6: 106,715,643 D380E possibly damaging Het
Ino80c C A 18: 24,121,808 probably benign Het
Kif18a T A 2: 109,333,621 W772R probably benign Het
Lipo3 G T 19: 33,580,480 Q171K probably damaging Het
Mga A T 2: 119,964,228 T2798S probably damaging Het
Mybpc1 T A 10: 88,558,575 T297S probably benign Het
Myh7 T G 14: 54,990,983 Q222P probably benign Het
N4bp2l2 T C 5: 150,661,897 D206G probably benign Het
Nacc2 G C 2: 26,062,204 T380S probably benign Het
Nkpd1 T A 7: 19,521,950 D186E probably damaging Het
Nol10 A T 12: 17,416,862 E581V probably benign Het
Ntrk1 A T 3: 87,786,059 N255K possibly damaging Het
Nudt5 T G 2: 5,864,417 D151E probably benign Het
Obscn A T 11: 59,002,032 L6796Q probably benign Het
Olfr730 A G 14: 50,186,542 I225T possibly damaging Het
Olfr763 C T 10: 129,011,933 A216V probably benign Het
Oxct2b A G 4: 123,117,045 T253A probably benign Het
Patl1 G A 19: 11,914,361 C10Y probably damaging Het
Pikfyve A G 1: 65,271,268 R1905G possibly damaging Het
Pkhd1l1 A G 15: 44,538,916 E2228G possibly damaging Het
Plcg1 A G 2: 160,748,066 K135E probably benign Het
Proz A G 8: 13,065,319 T112A probably benign Het
Prune2 A G 19: 17,121,835 N1568D probably benign Het
Rbm4 A G 19: 4,787,511 V431A probably benign Het
Rgs19 G T 2: 181,691,265 C40* probably null Het
Rimbp3 T A 16: 17,213,020 I1436K probably benign Het
Rnps1 T A 17: 24,422,202 M192K probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Slc17a9 G A 2: 180,738,417 V318I probably benign Het
Slc5a12 A G 2: 110,637,110 I412V probably damaging Het
Smc4 T A 3: 69,018,158 N329K probably benign Het
St3gal4 G A 9: 35,053,427 R165W probably damaging Het
Strbp G A 2: 37,603,937 R375* probably null Het
Tacc2 A G 7: 130,626,637 N1684S possibly damaging Het
Tet1 A T 10: 62,840,284 L671* probably null Het
Tex2 C A 11: 106,567,318 E429* probably null Het
Tgm4 T C 9: 123,040,476 I40T possibly damaging Het
Tmem132d C T 5: 127,792,612 D553N probably damaging Het
Tnks A T 8: 34,853,347 Y723* probably null Het
Tnks1bp1 A T 2: 85,063,976 T1416S probably benign Het
Tnxb T A 17: 34,685,672 L1137Q probably damaging Het
Tor4a A C 2: 25,195,190 C68G probably damaging Het
Tubb2b A C 13: 34,128,462 V116G probably damaging Het
Upb1 T A 10: 75,414,993 S99T probably benign Het
Vmn1r31 T A 6: 58,472,098 I261F unknown Het
Vmn1r53 T C 6: 90,223,589 Y251C probably benign Het
Vmn2r58 T C 7: 41,864,557 R221G Het
Vmn2r88 A T 14: 51,418,526 I740F possibly damaging Het
Zfp644 C T 5: 106,635,637 G1015R probably damaging Het
Zfy1 T C Y: 738,726 D160G unknown Het
Zscan25 T A 5: 145,286,390 V156E probably damaging Het
Zyg11b A T 4: 108,252,159 F443I Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8889:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R9031:Abcc2 UTSW 19 43822027 missense probably benign
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9345:Abcc2 UTSW 19 43819430 missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGACTTGGTGGTGTAGGC -3'
(R):5'- TGGTGGGGAGTATAATCAAAATTCG -3'

Sequencing Primer
(F):5'- TGGTGTAGGCAAGGGTCAG -3'
(R):5'- ACAAATCATTCAGGGCAAATATGTAG -3'
Posted On 2021-08-31