Incidental Mutation 'R8937:Atrn'
ID680700
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8937 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130999237 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1186 (D1186E)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: D1186E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: D1186E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,065 Y124* probably null Het
4930455H04Rik C A 3: 116,968,471 probably benign Het
Actn3 C T 19: 4,871,770 probably null Het
Akap13 T A 7: 75,534,853 probably null Het
Akap9 A T 5: 4,044,048 Q2190L possibly damaging Het
Ankrd6 A T 4: 32,823,452 V190D possibly damaging Het
Bank1 A T 3: 136,284,173 V52E probably damaging Het
Blmh A G 11: 76,967,057 N342D probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ces2f A G 8: 104,951,037 T225A probably damaging Het
Clic6 G T 16: 92,499,357 D302Y probably damaging Het
Clmn T A 12: 104,797,082 N95I probably damaging Het
Cmya5 A T 13: 93,096,332 F749L probably benign Het
Cramp1l A G 17: 24,983,982 F358L probably damaging Het
Dhx38 T C 8: 109,556,466 D573G probably damaging Het
Dync1h1 T C 12: 110,618,037 Y625H probably damaging Het
Enpep A G 3: 129,321,358 probably null Het
Fat1 T C 8: 45,030,313 L3146P probably damaging Het
Gal3st2b G A 1: 93,940,848 S265N probably benign Het
Glis3 G A 19: 28,665,866 A92V possibly damaging Het
Gm13089 T C 4: 143,696,992 Y409C probably damaging Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Hmcn2 A T 2: 31,314,415 M1L probably benign Het
Kcnj15 G A 16: 95,296,689 probably benign Het
Krt27 A G 11: 99,348,725 S310P probably damaging Het
Lama2 A T 10: 26,986,820 D2982E probably damaging Het
Lrfn3 A G 7: 30,360,026 V258A probably benign Het
Lrit3 A T 3: 129,800,544 M128K probably damaging Het
Ltbp3 A G 19: 5,747,484 T417A probably benign Het
Mettl25 T C 10: 105,765,261 T554A probably benign Het
Micall1 A G 15: 79,126,998 S523G probably damaging Het
Mmp21 G A 7: 133,678,971 A90V probably benign Het
Mon2 T C 10: 123,059,205 N53S probably benign Het
Mpp5 T A 12: 78,819,341 D313E probably benign Het
Muc15 T C 2: 110,731,907 probably null Het
Myo15b A T 11: 115,882,301 M431L probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5c3 T C 6: 56,884,716 D195G probably damaging Het
Olfr401 T A 11: 74,122,048 M253K probably benign Het
Olfr648 A G 7: 104,179,742 L222P possibly damaging Het
Pgrmc2 A G 3: 41,082,690 L102P probably damaging Het
Qrich2 CACCTGCTTGCAACACGCCAGGCTGAACTGCACCTAGCTGGACCATGCCAGGCTGAACTGAACC CACC 11: 116,457,245 probably benign Het
Ralgapa1 T G 12: 55,702,560 I1233L probably damaging Het
Rb1cc1 T A 1: 6,263,217 D68E probably benign Het
Rere C A 4: 150,614,874 probably benign Het
Rnf213 A T 11: 119,430,274 H1185L possibly damaging Het
Robo2 G A 16: 73,973,261 P529L probably damaging Het
Robo2 G T 16: 73,973,262 P529T probably damaging Het
Shprh A G 10: 11,185,437 T1165A possibly damaging Het
Slc43a1 T C 2: 84,860,106 L456P probably damaging Het
Slc5a8 T C 10: 88,905,023 Y267H probably damaging Het
Snrnp200 T C 2: 127,226,982 I927T probably benign Het
Sorbs1 T C 19: 40,373,562 D156G probably benign Het
Sox5 A T 6: 143,907,443 S370T probably benign Het
Spen T C 4: 141,474,063 T2418A probably damaging Het
St8sia6 A T 2: 13,696,894 L104H probably damaging Het
Stox1 T A 10: 62,664,651 N710I probably damaging Het
Syt11 G A 3: 88,747,744 P417S probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tfcp2l1 G A 1: 118,668,717 G394E possibly damaging Het
Tial1 A G 7: 128,454,991 I13T probably damaging Het
Tmem108 T C 9: 103,484,782 D535G probably benign Het
Tpp1 T C 7: 105,747,419 M464V probably benign Het
Trrap C A 5: 144,820,253 N2108K probably damaging Het
Tspan3 T C 9: 56,146,599 D156G probably benign Het
Ttn C T 2: 76,762,263 V20842I probably benign Het
Ubr4 T A 4: 139,463,575 W4078R probably damaging Het
Uts2r G A 11: 121,160,969 V220M possibly damaging Het
Vmn2r19 G A 6: 123,316,324 probably null Het
Vmn2r3 A T 3: 64,259,252 F819L probably damaging Het
Wdtc1 T C 4: 133,304,159 Y250C probably damaging Het
Zan T C 5: 137,395,626 H4521R unknown Het
Zfp219 A T 14: 52,006,767 C652S probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGAAACCTGCTTTAGTTTGTATC -3'
(R):5'- GGTCACAGGTTGAATATCATCAAG -3'

Sequencing Primer
(F):5'- ACCTGCTTTAGTTTGTATCAACAC -3'
(R):5'- ACCCTGATACTGTCTGCT -3'
Posted On2021-08-31