Incidental Mutation 'R8937:Enpep'
ID680705
Institutional Source Beutler Lab
Gene Symbol Enpep
Ensembl Gene ENSMUSG00000028024
Gene Nameglutamyl aminopeptidase
SynonymsLy51, aminopeptidase-A, Bp-1/6C3, 6030431M22Rik, APA, Ly-51
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8937 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location129269175-129332720 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 129321358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029658]
Predicted Effect probably null
Transcript: ENSMUST00000029658
SMART Domains Protein: ENSMUSP00000029658
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M1 84 474 6e-147 PFAM
Pfam:ERAP1_C 607 925 1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170918
SMART Domains Protein: ENSMUSP00000128872
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
Pfam:Peptidase_M1 12 402 9.6e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and morphologically unaffected with normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,065 Y124* probably null Het
4930455H04Rik C A 3: 116,968,471 probably benign Het
Actn3 C T 19: 4,871,770 probably null Het
Akap13 T A 7: 75,534,853 probably null Het
Akap9 A T 5: 4,044,048 Q2190L possibly damaging Het
Ankrd6 A T 4: 32,823,452 V190D possibly damaging Het
Atrn T A 2: 130,999,237 D1186E probably benign Het
Bank1 A T 3: 136,284,173 V52E probably damaging Het
Blmh A G 11: 76,967,057 N342D probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ces2f A G 8: 104,951,037 T225A probably damaging Het
Clic6 G T 16: 92,499,357 D302Y probably damaging Het
Clmn T A 12: 104,797,082 N95I probably damaging Het
Cmya5 A T 13: 93,096,332 F749L probably benign Het
Cramp1l A G 17: 24,983,982 F358L probably damaging Het
Dhx38 T C 8: 109,556,466 D573G probably damaging Het
Dync1h1 T C 12: 110,618,037 Y625H probably damaging Het
Fat1 T C 8: 45,030,313 L3146P probably damaging Het
Gal3st2b G A 1: 93,940,848 S265N probably benign Het
Glis3 G A 19: 28,665,866 A92V possibly damaging Het
Gm13089 T C 4: 143,696,992 Y409C probably damaging Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Hmcn2 A T 2: 31,314,415 M1L probably benign Het
Kcnj15 G A 16: 95,296,689 probably benign Het
Krt27 A G 11: 99,348,725 S310P probably damaging Het
Lama2 A T 10: 26,986,820 D2982E probably damaging Het
Lrfn3 A G 7: 30,360,026 V258A probably benign Het
Lrit3 A T 3: 129,800,544 M128K probably damaging Het
Ltbp3 A G 19: 5,747,484 T417A probably benign Het
Mettl25 T C 10: 105,765,261 T554A probably benign Het
Micall1 A G 15: 79,126,998 S523G probably damaging Het
Mmp21 G A 7: 133,678,971 A90V probably benign Het
Mon2 T C 10: 123,059,205 N53S probably benign Het
Mpp5 T A 12: 78,819,341 D313E probably benign Het
Muc15 T C 2: 110,731,907 probably null Het
Myo15b A T 11: 115,882,301 M431L probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5c3 T C 6: 56,884,716 D195G probably damaging Het
Olfr401 T A 11: 74,122,048 M253K probably benign Het
Olfr648 A G 7: 104,179,742 L222P possibly damaging Het
Pgrmc2 A G 3: 41,082,690 L102P probably damaging Het
Qrich2 CACCTGCTTGCAACACGCCAGGCTGAACTGCACCTAGCTGGACCATGCCAGGCTGAACTGAACC CACC 11: 116,457,245 probably benign Het
Ralgapa1 T G 12: 55,702,560 I1233L probably damaging Het
Rb1cc1 T A 1: 6,263,217 D68E probably benign Het
Rere C A 4: 150,614,874 probably benign Het
Rnf213 A T 11: 119,430,274 H1185L possibly damaging Het
Robo2 G A 16: 73,973,261 P529L probably damaging Het
Robo2 G T 16: 73,973,262 P529T probably damaging Het
Shprh A G 10: 11,185,437 T1165A possibly damaging Het
Slc43a1 T C 2: 84,860,106 L456P probably damaging Het
Slc5a8 T C 10: 88,905,023 Y267H probably damaging Het
Snrnp200 T C 2: 127,226,982 I927T probably benign Het
Sorbs1 T C 19: 40,373,562 D156G probably benign Het
Sox5 A T 6: 143,907,443 S370T probably benign Het
Spen T C 4: 141,474,063 T2418A probably damaging Het
St8sia6 A T 2: 13,696,894 L104H probably damaging Het
Stox1 T A 10: 62,664,651 N710I probably damaging Het
Syt11 G A 3: 88,747,744 P417S probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tfcp2l1 G A 1: 118,668,717 G394E possibly damaging Het
Tial1 A G 7: 128,454,991 I13T probably damaging Het
Tmem108 T C 9: 103,484,782 D535G probably benign Het
Tpp1 T C 7: 105,747,419 M464V probably benign Het
Trrap C A 5: 144,820,253 N2108K probably damaging Het
Tspan3 T C 9: 56,146,599 D156G probably benign Het
Ttn C T 2: 76,762,263 V20842I probably benign Het
Ubr4 T A 4: 139,463,575 W4078R probably damaging Het
Uts2r G A 11: 121,160,969 V220M possibly damaging Het
Vmn2r19 G A 6: 123,316,324 probably null Het
Vmn2r3 A T 3: 64,259,252 F819L probably damaging Het
Wdtc1 T C 4: 133,304,159 Y250C probably damaging Het
Zan T C 5: 137,395,626 H4521R unknown Het
Zfp219 A T 14: 52,006,767 C652S probably damaging Het
Other mutations in Enpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Enpep APN 3 129332082 missense possibly damaging 0.69
IGL01895:Enpep APN 3 129270334 missense possibly damaging 0.89
IGL02193:Enpep APN 3 129281687 missense possibly damaging 0.46
IGL02215:Enpep APN 3 129270277 splice site probably benign
IGL02511:Enpep APN 3 129321410 missense probably damaging 1.00
IGL02579:Enpep APN 3 129284090 missense probably benign 0.07
IGL02634:Enpep APN 3 129309857 missense probably damaging 1.00
IGL03034:Enpep APN 3 129298950 missense probably damaging 0.99
IGL03214:Enpep APN 3 129293247 missense probably benign
IGL03401:Enpep APN 3 129312620 missense probably benign 0.01
P0041:Enpep UTSW 3 129332198 missense possibly damaging 0.80
R0371:Enpep UTSW 3 129283867 critical splice donor site probably null
R0479:Enpep UTSW 3 129312674 missense possibly damaging 0.65
R1036:Enpep UTSW 3 129284109 missense probably damaging 0.99
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1584:Enpep UTSW 3 129319448 missense probably damaging 1.00
R2060:Enpep UTSW 3 129280523 missense probably benign 0.14
R2101:Enpep UTSW 3 129298938 missense probably benign 0.00
R2153:Enpep UTSW 3 129280582 missense probably damaging 0.99
R2474:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3618:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3619:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R4275:Enpep UTSW 3 129332278 missense probably benign 0.02
R4291:Enpep UTSW 3 129270317 nonsense probably null
R4438:Enpep UTSW 3 129284091 missense possibly damaging 0.94
R4570:Enpep UTSW 3 129281548 missense possibly damaging 0.67
R4678:Enpep UTSW 3 129303713 critical splice donor site probably null
R4679:Enpep UTSW 3 129303713 critical splice donor site probably null
R4748:Enpep UTSW 3 129332163 missense probably damaging 1.00
R4878:Enpep UTSW 3 129276771 missense probably benign 0.17
R4954:Enpep UTSW 3 129284180 missense probably damaging 0.98
R5074:Enpep UTSW 3 129303755 missense probably damaging 1.00
R5261:Enpep UTSW 3 129305426 missense probably damaging 1.00
R5328:Enpep UTSW 3 129280510 missense probably benign 0.30
R5661:Enpep UTSW 3 129276757 missense probably damaging 0.98
R5687:Enpep UTSW 3 129299094 splice site probably null
R5695:Enpep UTSW 3 129309099 missense probably damaging 1.00
R5697:Enpep UTSW 3 129309123 missense probably benign
R5889:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5940:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5968:Enpep UTSW 3 129280938 missense probably benign
R5976:Enpep UTSW 3 129299124 missense probably damaging 0.97
R6151:Enpep UTSW 3 129332418 missense possibly damaging 0.82
R6367:Enpep UTSW 3 129332081 missense possibly damaging 0.94
R6468:Enpep UTSW 3 129331860 critical splice donor site probably null
R6484:Enpep UTSW 3 129321481 missense probably damaging 0.96
R6938:Enpep UTSW 3 129298950 missense probably damaging 0.99
R6989:Enpep UTSW 3 129280950 missense probably damaging 1.00
R7073:Enpep UTSW 3 129312670 nonsense probably null
R7258:Enpep UTSW 3 129332075 missense probably benign 0.01
R7452:Enpep UTSW 3 129271403 missense possibly damaging 0.81
R7576:Enpep UTSW 3 129284091 missense probably benign 0.03
R7684:Enpep UTSW 3 129321445 missense probably damaging 1.00
R7697:Enpep UTSW 3 129309101 missense probably damaging 1.00
R8050:Enpep UTSW 3 129305516 missense probably damaging 1.00
R8080:Enpep UTSW 3 129299134 missense probably damaging 1.00
R8318:Enpep UTSW 3 129270337 missense probably damaging 1.00
R8423:Enpep UTSW 3 129309125 missense probably damaging 1.00
R8474:Enpep UTSW 3 129319427 missense probably damaging 1.00
R8532:Enpep UTSW 3 129276653 nonsense probably null
R8826:Enpep UTSW 3 129271418 missense probably damaging 0.97
R8884:Enpep UTSW 3 129321403 missense possibly damaging 0.88
R8936:Enpep UTSW 3 129332235 missense possibly damaging 0.63
R8959:Enpep UTSW 3 129319441 missense probably damaging 1.00
Z1177:Enpep UTSW 3 129276680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAACTGTGATGTCATAAGTTG -3'
(R):5'- TTTCTATAGGCGTAGAAACACAGG -3'

Sequencing Primer
(F):5'- GTTGACAATTTCCTAGAGGCAAAG -3'
(R):5'- GGAACTGTCAGCAGGGC -3'
Posted On2021-08-31