Incidental Mutation 'R8937:Shprh'
ID 680733
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8937 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11185437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1165 (T1165A)
Ref Sequence ENSEMBL: ENSMUSP00000132870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: T1165A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: T1165A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: T1165A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: T1165A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000159541
AA Change: T1165A

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: T1165A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (71/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,065 Y124* probably null Het
4930455H04Rik C A 3: 116,968,471 probably benign Het
Actn3 C T 19: 4,871,770 probably null Het
Akap13 T A 7: 75,534,853 probably null Het
Akap9 A T 5: 4,044,048 Q2190L possibly damaging Het
Ankrd6 A T 4: 32,823,452 V190D possibly damaging Het
Atrn T A 2: 130,999,237 D1186E probably benign Het
Bank1 A T 3: 136,284,173 V52E probably damaging Het
Blmh A G 11: 76,967,057 N342D probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ces2f A G 8: 104,951,037 T225A probably damaging Het
Clic6 G T 16: 92,499,357 D302Y probably damaging Het
Clmn T A 12: 104,797,082 N95I probably damaging Het
Cmya5 A T 13: 93,096,332 F749L probably benign Het
Cramp1l A G 17: 24,983,982 F358L probably damaging Het
Dhx38 T C 8: 109,556,466 D573G probably damaging Het
Dync1h1 T C 12: 110,618,037 Y625H probably damaging Het
Enpep A G 3: 129,321,358 probably null Het
Fat1 T C 8: 45,030,313 L3146P probably damaging Het
Gal3st2b G A 1: 93,940,848 S265N probably benign Het
Glis3 G A 19: 28,665,866 A92V possibly damaging Het
Gm13089 T C 4: 143,696,992 Y409C probably damaging Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Hmcn2 A T 2: 31,314,415 M1L probably benign Het
Kcnj15 G A 16: 95,296,689 probably benign Het
Krt27 A G 11: 99,348,725 S310P probably damaging Het
Lama2 A T 10: 26,986,820 D2982E probably damaging Het
Lrfn3 A G 7: 30,360,026 V258A probably benign Het
Lrit3 A T 3: 129,800,544 M128K probably damaging Het
Ltbp3 A G 19: 5,747,484 T417A probably benign Het
Mettl25 T C 10: 105,765,261 T554A probably benign Het
Micall1 A G 15: 79,126,998 S523G probably damaging Het
Mmp21 G A 7: 133,678,971 A90V probably benign Het
Mon2 T C 10: 123,059,205 N53S probably benign Het
Mpp5 T A 12: 78,819,341 D313E probably benign Het
Muc15 T C 2: 110,731,907 probably null Het
Myo15b A T 11: 115,882,301 M431L probably benign Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5c3 T C 6: 56,884,716 D195G probably damaging Het
Olfr401 T A 11: 74,122,048 M253K probably benign Het
Olfr648 A G 7: 104,179,742 L222P possibly damaging Het
Pgrmc2 A G 3: 41,082,690 L102P probably damaging Het
Plekha1 T G 7: 130,900,511 probably benign Het
Ralgapa1 T G 12: 55,702,560 I1233L probably damaging Het
Rb1cc1 T A 1: 6,263,217 D68E probably benign Het
Rere C A 4: 150,614,874 probably benign Het
Rnf213 A T 11: 119,430,274 H1185L possibly damaging Het
Robo2 G A 16: 73,973,261 P529L probably damaging Het
Robo2 G T 16: 73,973,262 P529T probably damaging Het
Slc22a26 C T 19: 7,791,025 probably benign Het
Slc43a1 T C 2: 84,860,106 L456P probably damaging Het
Slc5a8 T C 10: 88,905,023 Y267H probably damaging Het
Snrnp200 T C 2: 127,226,982 I927T probably benign Het
Sorbs1 T C 19: 40,373,562 D156G probably benign Het
Sox5 A T 6: 143,907,443 S370T probably benign Het
Spen T C 4: 141,474,063 T2418A probably damaging Het
St8sia6 A T 2: 13,696,894 L104H probably damaging Het
Stox1 T A 10: 62,664,651 N710I probably damaging Het
Syncrip T C 9: 88,462,847 probably benign Het
Syt11 G A 3: 88,747,744 P417S probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tfcp2l1 G A 1: 118,668,717 G394E possibly damaging Het
Tial1 A G 7: 128,454,991 I13T probably damaging Het
Tmem108 T C 9: 103,484,782 D535G probably benign Het
Tpp1 T C 7: 105,747,419 M464V probably benign Het
Trrap C A 5: 144,820,253 N2108K probably damaging Het
Tspan3 T C 9: 56,146,599 D156G probably benign Het
Ttn C T 2: 76,762,263 V20842I probably benign Het
Ubr4 T A 4: 139,463,575 W4078R probably damaging Het
Uts2r G A 11: 121,160,969 V220M possibly damaging Het
Vmn2r19 G A 6: 123,316,324 probably null Het
Vmn2r3 A T 3: 64,259,252 F819L probably damaging Het
Wdtc1 T C 4: 133,304,159 Y250C probably damaging Het
Zan T C 5: 137,395,626 H4521R unknown Het
Zfp219 A T 14: 52,006,767 C652S probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
R9668:Shprh UTSW 10 11206332 missense probably damaging 0.97
R9709:Shprh UTSW 10 11162830 missense possibly damaging 0.91
R9718:Shprh UTSW 10 11213504 missense probably damaging 1.00
R9750:Shprh UTSW 10 11164460 missense probably damaging 0.98
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGTATTTGCCCAATACACACAG -3'
(R):5'- GGAGAACATTTCAAATGGCTAACAG -3'

Sequencing Primer
(F):5'- TGTATCTCTTTTCCCATTGAATGC -3'
(R):5'- ATGTCCCTAAGTCCATGG -3'
Posted On 2021-08-31