Mutagenetix > Incidental Mutation

Incidental Mutation 'R8937:Rnf213'

680744

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

068710-MU

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8937 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119430274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1185 (H1185L)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: H1186L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131035
AA Change: H1185L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: H1185L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

95% (71/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,926,065	Y124*	probably null	Het
4930455H04Rik	C	A	3: 116,968,471		probably benign	Het
Actn3	C	T	19: 4,871,770		probably null	Het
Akap13	T	A	7: 75,534,853		probably null	Het
Akap9	A	T	5: 4,044,048	Q2190L	possibly damaging	Het
Ankrd6	A	T	4: 32,823,452	V190D	possibly damaging	Het
Atrn	T	A	2: 130,999,237	D1186E	probably benign	Het
Bank1	A	T	3: 136,284,173	V52E	probably damaging	Het
Blmh	A	G	11: 76,967,057	N342D	probably benign	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Ces2f	A	G	8: 104,951,037	T225A	probably damaging	Het
Clic6	G	T	16: 92,499,357	D302Y	probably damaging	Het
Clmn	T	A	12: 104,797,082	N95I	probably damaging	Het
Cmya5	A	T	13: 93,096,332	F749L	probably benign	Het
Cramp1l	A	G	17: 24,983,982	F358L	probably damaging	Het
Dhx38	T	C	8: 109,556,466	D573G	probably damaging	Het
Dync1h1	T	C	12: 110,618,037	Y625H	probably damaging	Het
Enpep	A	G	3: 129,321,358		probably null	Het
Fat1	T	C	8: 45,030,313	L3146P	probably damaging	Het
Gal3st2b	G	A	1: 93,940,848	S265N	probably benign	Het
Glis3	G	A	19: 28,665,866	A92V	possibly damaging	Het
Gm13089	T	C	4: 143,696,992	Y409C	probably damaging	Het
Gm266	T	C	12: 111,485,739	D11G	probably benign	Het
Hmcn2	A	T	2: 31,314,415	M1L	probably benign	Het
Kcnj15	G	A	16: 95,296,689		probably benign	Het
Krt27	A	G	11: 99,348,725	S310P	probably damaging	Het
Lama2	A	T	10: 26,986,820	D2982E	probably damaging	Het
Lrfn3	A	G	7: 30,360,026	V258A	probably benign	Het
Lrit3	A	T	3: 129,800,544	M128K	probably damaging	Het
Ltbp3	A	G	19: 5,747,484	T417A	probably benign	Het
Mettl25	T	C	10: 105,765,261	T554A	probably benign	Het
Micall1	A	G	15: 79,126,998	S523G	probably damaging	Het
Mmp21	G	A	7: 133,678,971	A90V	probably benign	Het
Mon2	T	C	10: 123,059,205	N53S	probably benign	Het
Mpp5	T	A	12: 78,819,341	D313E	probably benign	Het
Muc15	T	C	2: 110,731,907		probably null	Het
Myo15b	A	T	11: 115,882,301	M431L	probably benign	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nt5c3	T	C	6: 56,884,716	D195G	probably damaging	Het
Olfr401	T	A	11: 74,122,048	M253K	probably benign	Het
Olfr648	A	G	7: 104,179,742	L222P	possibly damaging	Het
Pgrmc2	A	G	3: 41,082,690	L102P	probably damaging	Het
Plekha1	T	G	7: 130,900,511		probably benign	Het
Ralgapa1	T	G	12: 55,702,560	I1233L	probably damaging	Het
Rb1cc1	T	A	1: 6,263,217	D68E	probably benign	Het
Rere	C	A	4: 150,614,874		probably benign	Het
Robo2	G	A	16: 73,973,261	P529L	probably damaging	Het
Robo2	G	T	16: 73,973,262	P529T	probably damaging	Het
Shprh	A	G	10: 11,185,437	T1165A	possibly damaging	Het
Slc22a26	C	T	19: 7,791,025		probably benign	Het
Slc43a1	T	C	2: 84,860,106	L456P	probably damaging	Het
Slc5a8	T	C	10: 88,905,023	Y267H	probably damaging	Het
Snrnp200	T	C	2: 127,226,982	I927T	probably benign	Het
Sorbs1	T	C	19: 40,373,562	D156G	probably benign	Het
Sox5	A	T	6: 143,907,443	S370T	probably benign	Het
Spen	T	C	4: 141,474,063	T2418A	probably damaging	Het
St8sia6	A	T	2: 13,696,894	L104H	probably damaging	Het
Stox1	T	A	10: 62,664,651	N710I	probably damaging	Het
Syncrip	T	C	9: 88,462,847		probably benign	Het
Syt11	G	A	3: 88,747,744	P417S	probably damaging	Het
Taf2	A	T	15: 55,047,453	N608K	probably benign	Het
Tfcp2l1	G	A	1: 118,668,717	G394E	possibly damaging	Het
Tial1	A	G	7: 128,454,991	I13T	probably damaging	Het
Tmem108	T	C	9: 103,484,782	D535G	probably benign	Het
Tpp1	T	C	7: 105,747,419	M464V	probably benign	Het
Trrap	C	A	5: 144,820,253	N2108K	probably damaging	Het
Tspan3	T	C	9: 56,146,599	D156G	probably benign	Het
Ttn	C	T	2: 76,762,263	V20842I	probably benign	Het
Ubr4	T	A	4: 139,463,575	W4078R	probably damaging	Het
Uts2r	G	A	11: 121,160,969	V220M	possibly damaging	Het
Vmn2r19	G	A	6: 123,316,324		probably null	Het
Vmn2r3	A	T	3: 64,259,252	F819L	probably damaging	Het
Wdtc1	T	C	4: 133,304,159	Y250C	probably damaging	Het
Zan	T	C	5: 137,395,626	H4521R	unknown	Het
Zfp219	A	T	14: 52,006,767	C652S	probably damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119449343	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119440843	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119447237	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119483118	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119443300	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119449876	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119436352	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119441307	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119442266	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119443015	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119416457	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119443268	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119418309	splice site	probably benign
IGL02084:Rnf213	APN	11	119445673	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119440650	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119480907	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119463336	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119436802	missense	probably benign
IGL02588:Rnf213	APN	11	119416536	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119440789	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119435066	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119427510	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119479941	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119445626	splice site	probably benign
IGL03057:Rnf213	APN	11	119441087	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119465007	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119474172	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119443004	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119421468	missense	probably benign	0.34
attrition	UTSW	11	119430321	missense	possibly damaging	0.77
defame	UTSW	11	119430281	nonsense	probably null
Derogate	UTSW	11	119470210	missense	probably damaging	1.00
dinky	UTSW	11	119416458	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119434742	missense
Impugn	UTSW	11	119436823	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119436676	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119426069	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119434742	missense
PIT4585001:Rnf213	UTSW	11	119458392	missense
R0008:Rnf213	UTSW	11	119465052	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119441606	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119402575	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119414587	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119416496	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119479600	nonsense	probably null
R0184:Rnf213	UTSW	11	119414521	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119438105	nonsense	probably null
R0365:Rnf213	UTSW	11	119426111	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119447257	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119426012	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119443120	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119465082	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119443280	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119431717	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119470210	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119441834	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119441150	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119441068	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119473480	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119423095	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119430486	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119414570	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119416563	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119452581	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119485998	splice site	probably benign
R1104:Rnf213	UTSW	11	119477229	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119435983	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119436177	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119436005	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119442400	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119437750	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119480889	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119441888	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119442707	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119441839	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119414526	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119436611	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119463345	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119442579	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119437672	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119440221	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119441183	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119450129	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119416448	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119431685	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119480895	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119441107	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119436022	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119461918	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119467302	nonsense	probably null
R2109:Rnf213	UTSW	11	119442663	nonsense	probably null
R2115:Rnf213	UTSW	11	119428013	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119450201	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119443690	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119415193	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119415070	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119460009	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119436428	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119414604	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119443195	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119459938	splice site	probably null
R2698:Rnf213	UTSW	11	119410144	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119468892	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119441976	nonsense	probably null
R3808:Rnf213	UTSW	11	119479558	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119480939	splice site	probably benign
R3856:Rnf213	UTSW	11	119480939	splice site	probably benign
R3973:Rnf213	UTSW	11	119469053	missense
R4014:Rnf213	UTSW	11	119445729	nonsense	probably null
R4049:Rnf213	UTSW	11	119482448	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119483006	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119409482	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119441243	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119436823	nonsense	probably null
R4332:Rnf213	UTSW	11	119436676	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119483964	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119479670	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119437695	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119441125	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119440349	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119445745	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119416629	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119442763	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119481240	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119428157	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119436764	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119410807	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119458866	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119440816	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119440808	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119409020	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119415076	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119433499	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119436629	missense	probably benign	0.04
R5636:Rnf213	UTSW	11	119436905	missense	probably damaging	1.00
R5669:Rnf213	UTSW	11	119458785	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119434686	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119483894	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119416458	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119436295	missense	probably benign
R5861:Rnf213	UTSW	11	119473377	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119421369	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119443079	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119486010	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119442101	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119416559	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119411513	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119411470	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119442028	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119435999	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119458428	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119414548	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119463366	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119477078	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119459966	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119452687	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119436280	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119479920	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119430321	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119442271	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119442236	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119462285	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119448838	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119449866	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119479655	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119437604	splice site	probably null
R7170:Rnf213	UTSW	11	119452575	missense
R7185:Rnf213	UTSW	11	119424198	missense
R7239:Rnf213	UTSW	11	119458788	missense
R7258:Rnf213	UTSW	11	119452575	missense
R7259:Rnf213	UTSW	11	119452575	missense
R7260:Rnf213	UTSW	11	119452575	missense
R7273:Rnf213	UTSW	11	119431756	splice site	probably null
R7282:Rnf213	UTSW	11	119437992	missense
R7311:Rnf213	UTSW	11	119416547	missense
R7352:Rnf213	UTSW	11	119443579	missense
R7369:Rnf213	UTSW	11	119430468	missense
R7410:Rnf213	UTSW	11	119435051	missense
R7448:Rnf213	UTSW	11	119481291	missense
R7561:Rnf213	UTSW	11	119441719	missense
R7573:Rnf213	UTSW	11	119458484	missense
R7615:Rnf213	UTSW	11	119467297	missense
R7680:Rnf213	UTSW	11	119479556	missense
R7739:Rnf213	UTSW	11	119410861	missense
R7789:Rnf213	UTSW	11	119470219	splice site	probably null
R7806:Rnf213	UTSW	11	119411545	missense
R8031:Rnf213	UTSW	11	119430281	nonsense	probably null
R8042:Rnf213	UTSW	11	119441654	missense
R8053:Rnf213	UTSW	11	119402647	missense
R8284:Rnf213	UTSW	11	119428083	missense
R8301:Rnf213	UTSW	11	119434742	missense
R8325:Rnf213	UTSW	11	119430445	missense
R8332:Rnf213	UTSW	11	119483698	missense
R8443:Rnf213	UTSW	11	119449323	missense
R8518:Rnf213	UTSW	11	119462217	missense
R8531:Rnf213	UTSW	11	119474205	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119458737	missense
R8675:Rnf213	UTSW	11	119456158	missense
R8690:Rnf213	UTSW	11	119418129	missense
R8690:Rnf213	UTSW	11	119441212	missense
R8714:Rnf213	UTSW	11	119468894	missense
R8802:Rnf213	UTSW	11	119462102	missense
R8861:Rnf213	UTSW	11	119442236	missense
R8886:Rnf213	UTSW	11	119473438	missense
R8893:Rnf213	UTSW	11	119443042	missense
R8941:Rnf213	UTSW	11	119414424	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119461930	missense
R8983:Rnf213	UTSW	11	119430349	missense
R9043:Rnf213	UTSW	11	119458913	missense
R9081:Rnf213	UTSW	11	119466236	missense
R9132:Rnf213	UTSW	11	119483916	missense
R9135:Rnf213	UTSW	11	119408747	missense
R9146:Rnf213	UTSW	11	119443673	missense
R9156:Rnf213	UTSW	11	119440748	missense
R9183:Rnf213	UTSW	11	119427622	missense
R9234:Rnf213	UTSW	11	119450117	missense
R9275:Rnf213	UTSW	11	119435942	missense
R9278:Rnf213	UTSW	11	119435942	missense
R9296:Rnf213	UTSW	11	119443795	splice site	probably benign
R9350:Rnf213	UTSW	11	119442149	missense
R9366:Rnf213	UTSW	11	119436231	missense
R9413:Rnf213	UTSW	11	119466233	missense
R9444:Rnf213	UTSW	11	119434797	missense
R9464:Rnf213	UTSW	11	119463580	missense
R9605:Rnf213	UTSW	11	119469053	missense
R9649:Rnf213	UTSW	11	119479631	missense
R9651:Rnf213	UTSW	11	119440412	missense
R9664:Rnf213	UTSW	11	119441968	missense
R9696:Rnf213	UTSW	11	119468980	missense
R9710:Rnf213	UTSW	11	119441005	missense
R9797:Rnf213	UTSW	11	119442539	missense
S24628:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119441824	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119473513	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119440463	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119477254	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119441410	missense
Z1176:Rnf213	UTSW	11	119482998	missense

Predicted Primers

PCR Primer
(F):5'- TTTCCCCTACACTAAGGAGGAG -3'
(R):5'- GGTTGTACAGGTATTCCAAGACC -3'

Sequencing Primer
(F):5'- AGGCCTTTAATCCCAGCACGG -3'
(R):5'- GGTATTCCAAGACCTCTGGAAGC -3'

Posted On

2021-08-31