Incidental Mutation 'R8937:Cramp1'
ID 680760
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 068710-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8937 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25202956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 358 (F358L)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: F358L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: F358L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (71/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik C A 3: 116,762,120 (GRCm39) probably benign Het
Actn3 C T 19: 4,921,798 (GRCm39) probably null Het
Akap13 T A 7: 75,184,601 (GRCm39) probably null Het
Akap9 A T 5: 4,094,048 (GRCm39) Q2190L possibly damaging Het
Ankrd6 A T 4: 32,823,452 (GRCm39) V190D possibly damaging Het
Atrn T A 2: 130,841,157 (GRCm39) D1186E probably benign Het
Bank1 A T 3: 135,989,934 (GRCm39) V52E probably damaging Het
Blmh A G 11: 76,857,883 (GRCm39) N342D probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ces2f A G 8: 105,677,669 (GRCm39) T225A probably damaging Het
Clic6 G T 16: 92,296,245 (GRCm39) D302Y probably damaging Het
Clmn T A 12: 104,763,341 (GRCm39) N95I probably damaging Het
Cmya5 A T 13: 93,232,840 (GRCm39) F749L probably benign Het
Dhx38 T C 8: 110,283,098 (GRCm39) D573G probably damaging Het
Dync1h1 T C 12: 110,584,471 (GRCm39) Y625H probably damaging Het
Enpep A G 3: 129,115,007 (GRCm39) probably null Het
Fat1 T C 8: 45,483,350 (GRCm39) L3146P probably damaging Het
Gal3st2b G A 1: 93,868,570 (GRCm39) S265N probably benign Het
Glis3 G A 19: 28,643,266 (GRCm39) A92V possibly damaging Het
Gm266 T C 12: 111,452,173 (GRCm39) D11G probably benign Het
Hmcn2 A T 2: 31,204,427 (GRCm39) M1L probably benign Het
Kcnj15 G A 16: 95,097,548 (GRCm39) probably benign Het
Krt27 A G 11: 99,239,551 (GRCm39) S310P probably damaging Het
Lama2 A T 10: 26,862,816 (GRCm39) D2982E probably damaging Het
Lrfn3 A G 7: 30,059,451 (GRCm39) V258A probably benign Het
Lrit3 A T 3: 129,594,193 (GRCm39) M128K probably damaging Het
Ltbp3 A G 19: 5,797,512 (GRCm39) T417A probably benign Het
Mettl25 T C 10: 105,601,122 (GRCm39) T554A probably benign Het
Micall1 A G 15: 79,011,198 (GRCm39) S523G probably damaging Het
Mmp21 G A 7: 133,280,700 (GRCm39) A90V probably benign Het
Mon2 T C 10: 122,895,110 (GRCm39) N53S probably benign Het
Muc15 T C 2: 110,562,252 (GRCm39) probably null Het
Myo15b A T 11: 115,773,127 (GRCm39) M431L probably benign Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nt5c3 T C 6: 56,861,701 (GRCm39) D195G probably damaging Het
Or3a1b T A 11: 74,012,874 (GRCm39) M253K probably benign Het
Or52h1 A G 7: 103,828,949 (GRCm39) L222P possibly damaging Het
Pals1 T A 12: 78,866,115 (GRCm39) D313E probably benign Het
Pgrmc2 A G 3: 41,037,125 (GRCm39) L102P probably damaging Het
Plekha1 T G 7: 130,502,241 (GRCm39) probably benign Het
Pramel23 T C 4: 143,423,562 (GRCm39) Y409C probably damaging Het
Prss59 A T 6: 40,902,999 (GRCm39) Y124* probably null Het
Ralgapa1 T G 12: 55,749,345 (GRCm39) I1233L probably damaging Het
Rb1cc1 T A 1: 6,333,441 (GRCm39) D68E probably benign Het
Rere C A 4: 150,699,331 (GRCm39) probably benign Het
Rnf213 A T 11: 119,321,100 (GRCm39) H1185L possibly damaging Het
Robo2 G T 16: 73,770,150 (GRCm39) P529T probably damaging Het
Robo2 G A 16: 73,770,149 (GRCm39) P529L probably damaging Het
Shprh A G 10: 11,061,181 (GRCm39) T1165A possibly damaging Het
Slc22a26 C T 19: 7,768,390 (GRCm39) probably benign Het
Slc43a1 T C 2: 84,690,450 (GRCm39) L456P probably damaging Het
Slc5a8 T C 10: 88,740,885 (GRCm39) Y267H probably damaging Het
Snrnp200 T C 2: 127,068,902 (GRCm39) I927T probably benign Het
Sorbs1 T C 19: 40,362,006 (GRCm39) D156G probably benign Het
Sox5 A T 6: 143,853,169 (GRCm39) S370T probably benign Het
Spen T C 4: 141,201,374 (GRCm39) T2418A probably damaging Het
St8sia6 A T 2: 13,701,705 (GRCm39) L104H probably damaging Het
Stox1 T A 10: 62,500,430 (GRCm39) N710I probably damaging Het
Syncrip T C 9: 88,344,900 (GRCm39) probably benign Het
Syt11 G A 3: 88,655,051 (GRCm39) P417S probably damaging Het
Taf2 A T 15: 54,910,849 (GRCm39) N608K probably benign Het
Tfcp2l1 G A 1: 118,596,447 (GRCm39) G394E possibly damaging Het
Tial1 A G 7: 128,056,715 (GRCm39) I13T probably damaging Het
Tmem108 T C 9: 103,361,981 (GRCm39) D535G probably benign Het
Tpp1 T C 7: 105,396,626 (GRCm39) M464V probably benign Het
Trrap C A 5: 144,757,063 (GRCm39) N2108K probably damaging Het
Tspan3 T C 9: 56,053,883 (GRCm39) D156G probably benign Het
Ttn C T 2: 76,592,607 (GRCm39) V20842I probably benign Het
Ubr4 T A 4: 139,190,886 (GRCm39) W4078R probably damaging Het
Uts2r G A 11: 121,051,795 (GRCm39) V220M possibly damaging Het
Vmn2r19 G A 6: 123,293,283 (GRCm39) probably null Het
Vmn2r3 A T 3: 64,166,673 (GRCm39) F819L probably damaging Het
Wdtc1 T C 4: 133,031,470 (GRCm39) Y250C probably damaging Het
Zan T C 5: 137,393,888 (GRCm39) H4521R unknown Het
Zfp219 A T 14: 52,244,224 (GRCm39) C652S probably damaging Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTGCAAGTAGTTCCGAGGC -3'
(R):5'- GCTTTATGTGAAGCTACAGCG -3'

Sequencing Primer
(F):5'- TAGTTCCGAGGCAGGACTCTCTAC -3'
(R):5'- GCTACAGCGATTTCAACAGATG -3'
Posted On 2021-08-31