Incidental Mutation 'R8938:Pik3c2b'
ID 680768
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms C330011J12Rik, PI3K-C2beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R8938 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 133045667-133108687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133088330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 877 (W877R)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably benign
Transcript: ENSMUST00000077730
AA Change: W877R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: W877R

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A G 4: 73,943,187 S59P probably damaging Het
Abcc8 G T 7: 46,166,994 H241N Het
Acsm1 T C 7: 119,659,162 S493P probably damaging Het
Agtr1a T C 13: 30,381,066 I38T probably damaging Het
Ahnak T C 19: 9,011,735 I3461T probably benign Het
Bbox1 T A 2: 110,270,184 T223S probably benign Het
BC055324 C T 1: 163,961,972 V665I probably benign Het
Brip1 T C 11: 86,148,401 K436E possibly damaging Het
Cdhr1 T A 14: 37,087,448 T299S probably benign Het
Cr2 T C 1: 195,171,116 D18G probably damaging Het
Cyp51 T C 5: 4,100,202 I174V probably benign Het
Dnah2 A T 11: 69,437,928 Y3290N probably damaging Het
Fcho1 T G 8: 71,717,146 K111T possibly damaging Het
Gli2 A T 1: 118,836,205 D1405E probably damaging Het
Gsg1l2 A G 11: 67,789,573 H278R possibly damaging Het
H2-K1 T C 17: 33,997,320 H284R probably damaging Het
Ighv1-62-1 C T 12: 115,387,115 W5* probably null Het
Ighv1-81 T A 12: 115,920,368 T88S probably benign Het
Igkv4-57 T A 6: 69,576,272 M19L probably benign Het
Klk1b3 G T 7: 44,200,305 W38L probably damaging Het
Lama3 T C 18: 12,556,705 S2835P probably damaging Het
Lhx8 T C 3: 154,322,387 N145S possibly damaging Het
Mfsd6 A T 1: 52,709,295 L137H probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mpst A T 15: 78,410,070 M1L possibly damaging Het
Mrpl2 T A 17: 46,646,312 probably benign Het
Mybpc3 T C 2: 91,123,949 V224A probably damaging Het
Nol4l T C 2: 153,420,731 D63G probably damaging Het
Olfr957 A T 9: 39,511,614 Y35* probably null Het
Patz1 C T 11: 3,290,660 T16I probably damaging Het
Pcdha3 A G 18: 36,947,101 I299V probably benign Het
Pcdhb18 G T 18: 37,490,484 R289L probably benign Het
Pcdhga6 A T 18: 37,708,509 R427S probably benign Het
Pcdhga8 T A 18: 37,726,902 V337E probably damaging Het
Plcg2 T C 8: 117,504,375 probably null Het
Prp2 C A 6: 132,600,618 H289Q unknown Het
Rac2 A G 15: 78,561,912 L192P probably damaging Het
Rfx4 T A 10: 84,840,072 Y51N probably damaging Het
Rptn A T 3: 93,395,025 Q16L possibly damaging Het
Ryr1 C T 7: 29,101,933 G802D probably damaging Het
Shroom3 T C 5: 92,943,071 S1146P probably damaging Het
Stam T C 2: 14,129,173 probably null Het
Vmn2r100 A G 17: 19,531,563 M623V probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Xkr7 T C 2: 153,032,213 F67L probably damaging Het
Zfp451 A T 1: 33,802,982 probably benign Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp974 A T 7: 27,910,886 H471Q possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133077396 missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
R8997:Pik3c2b UTSW 1 133090779 missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133077449 missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133084987 critical splice donor site probably null
R9621:Pik3c2b UTSW 1 133071607 missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133094749 missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133090850 missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133091600 missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTGAATGGTAGCGTGTG -3'
(R):5'- AGTGGTAAACTCTATGTGACGTGC -3'

Sequencing Primer
(F):5'- AGCAGTTCTGTGTGCCC -3'
(R):5'- TGACGTGCACCTGGGGATAC -3'
Posted On 2021-08-31