Incidental Mutation 'R8938:2310002L09Rik'
ID 680778
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene Name RIKEN cDNA 2310002L09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8938 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 73939371-73950846 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73943187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 59 (S59P)
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
AlphaFold Q9D7L5
Predicted Effect probably damaging
Transcript: ENSMUST00000030101
AA Change: S59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396
AA Change: S59P

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095023
AA Change: S59P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396
AA Change: S59P

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 G T 7: 46,166,994 H241N Het
Acsm1 T C 7: 119,659,162 S493P probably damaging Het
Agtr1a T C 13: 30,381,066 I38T probably damaging Het
Ahnak T C 19: 9,011,735 I3461T probably benign Het
Bbox1 T A 2: 110,270,184 T223S probably benign Het
BC055324 C T 1: 163,961,972 V665I probably benign Het
Brip1 T C 11: 86,148,401 K436E possibly damaging Het
Cdhr1 T A 14: 37,087,448 T299S probably benign Het
Cr2 T C 1: 195,171,116 D18G probably damaging Het
Cyp51 T C 5: 4,100,202 I174V probably benign Het
Dnah2 A T 11: 69,437,928 Y3290N probably damaging Het
Fcho1 T G 8: 71,717,146 K111T possibly damaging Het
Gli2 A T 1: 118,836,205 D1405E probably damaging Het
Gsg1l2 A G 11: 67,789,573 H278R possibly damaging Het
H2-K1 T C 17: 33,997,320 H284R probably damaging Het
Ighv1-62-1 C T 12: 115,387,115 W5* probably null Het
Ighv1-81 T A 12: 115,920,368 T88S probably benign Het
Igkv4-57 T A 6: 69,576,272 M19L probably benign Het
Klk1b3 G T 7: 44,200,305 W38L probably damaging Het
Lama3 T C 18: 12,556,705 S2835P probably damaging Het
Lhx8 T C 3: 154,322,387 N145S possibly damaging Het
Mfsd6 A T 1: 52,709,295 L137H probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mpst A T 15: 78,410,070 M1L possibly damaging Het
Mrpl2 T A 17: 46,646,312 probably benign Het
Mybpc3 T C 2: 91,123,949 V224A probably damaging Het
Nol4l T C 2: 153,420,731 D63G probably damaging Het
Olfr957 A T 9: 39,511,614 Y35* probably null Het
Patz1 C T 11: 3,290,660 T16I probably damaging Het
Pcdha3 A G 18: 36,947,101 I299V probably benign Het
Pcdhb18 G T 18: 37,490,484 R289L probably benign Het
Pcdhga6 A T 18: 37,708,509 R427S probably benign Het
Pcdhga8 T A 18: 37,726,902 V337E probably damaging Het
Pik3c2b T A 1: 133,088,330 W877R probably benign Het
Plcg2 T C 8: 117,504,375 probably null Het
Prp2 C A 6: 132,600,618 H289Q unknown Het
Rac2 A G 15: 78,561,912 L192P probably damaging Het
Rfx4 T A 10: 84,840,072 Y51N probably damaging Het
Rptn A T 3: 93,395,025 Q16L possibly damaging Het
Ryr1 C T 7: 29,101,933 G802D probably damaging Het
Shroom3 T C 5: 92,943,071 S1146P probably damaging Het
Stam T C 2: 14,129,173 probably null Het
Vmn2r100 A G 17: 19,531,563 M623V probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Xkr7 T C 2: 153,032,213 F67L probably damaging Het
Zfp451 A T 1: 33,802,982 probably benign Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp974 A T 7: 27,910,886 H471Q possibly damaging Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73942719 missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73950700 utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73950667 missense possibly damaging 0.94
R0841:2310002L09Rik UTSW 4 73942749 missense probably benign
R2919:2310002L09Rik UTSW 4 73950608 missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73942878 missense probably benign 0.00
R6795:2310002L09Rik UTSW 4 73950828 start gained probably benign
R6889:2310002L09Rik UTSW 4 73943053 missense probably benign 0.19
R7709:2310002L09Rik UTSW 4 73942854 missense possibly damaging 0.52
R7793:2310002L09Rik UTSW 4 73942935 missense probably benign 0.05
R8517:2310002L09Rik UTSW 4 73942969 missense probably damaging 1.00
R8671:2310002L09Rik UTSW 4 73942929 missense probably damaging 1.00
R8867:2310002L09Rik UTSW 4 73942850 missense probably damaging 1.00
R9618:2310002L09Rik UTSW 4 73950697 start codon destroyed probably null 0.46
Predicted Primers PCR Primer
(F):5'- CTACATCCTCAAACGTATCTGTGTC -3'
(R):5'- TAGCCAACGAGGTCTGACAC -3'

Sequencing Primer
(F):5'- CTCTTTCTAACACAAACCTAGATGG -3'
(R):5'- GCCAACGAGGTCTGACACTAATATG -3'
Posted On 2021-08-31