Incidental Mutation 'R8938:Fcho1'
ID 680788
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R8938 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 71717146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 111 (K111T)
Ref Sequence ENSEMBL: ENSMUSP00000119273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: K111T

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: K111T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136640
AA Change: K111T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000
AA Change: K111T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: K111T

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: K111T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153800
AA Change: K111T

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000
AA Change: K111T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A G 4: 73,943,187 S59P probably damaging Het
Abcc8 G T 7: 46,166,994 H241N Het
Acsm1 T C 7: 119,659,162 S493P probably damaging Het
Agtr1a T C 13: 30,381,066 I38T probably damaging Het
Ahnak T C 19: 9,011,735 I3461T probably benign Het
Bbox1 T A 2: 110,270,184 T223S probably benign Het
BC055324 C T 1: 163,961,972 V665I probably benign Het
Brip1 T C 11: 86,148,401 K436E possibly damaging Het
Cdhr1 T A 14: 37,087,448 T299S probably benign Het
Cr2 T C 1: 195,171,116 D18G probably damaging Het
Cyp51 T C 5: 4,100,202 I174V probably benign Het
Dnah2 A T 11: 69,437,928 Y3290N probably damaging Het
Gli2 A T 1: 118,836,205 D1405E probably damaging Het
Gsg1l2 A G 11: 67,789,573 H278R possibly damaging Het
H2-K1 T C 17: 33,997,320 H284R probably damaging Het
Ighv1-62-1 C T 12: 115,387,115 W5* probably null Het
Ighv1-81 T A 12: 115,920,368 T88S probably benign Het
Igkv4-57 T A 6: 69,576,272 M19L probably benign Het
Klk1b3 G T 7: 44,200,305 W38L probably damaging Het
Lama3 T C 18: 12,556,705 S2835P probably damaging Het
Lhx8 T C 3: 154,322,387 N145S possibly damaging Het
Mfsd6 A T 1: 52,709,295 L137H probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mpst A T 15: 78,410,070 M1L possibly damaging Het
Mrpl2 T A 17: 46,646,312 probably benign Het
Mybpc3 T C 2: 91,123,949 V224A probably damaging Het
Nol4l T C 2: 153,420,731 D63G probably damaging Het
Olfr957 A T 9: 39,511,614 Y35* probably null Het
Patz1 C T 11: 3,290,660 T16I probably damaging Het
Pcdha3 A G 18: 36,947,101 I299V probably benign Het
Pcdhb18 G T 18: 37,490,484 R289L probably benign Het
Pcdhga6 A T 18: 37,708,509 R427S probably benign Het
Pcdhga8 T A 18: 37,726,902 V337E probably damaging Het
Pik3c2b T A 1: 133,088,330 W877R probably benign Het
Plcg2 T C 8: 117,504,375 probably null Het
Prp2 C A 6: 132,600,618 H289Q unknown Het
Rac2 A G 15: 78,561,912 L192P probably damaging Het
Rfx4 T A 10: 84,840,072 Y51N probably damaging Het
Rptn A T 3: 93,395,025 Q16L possibly damaging Het
Ryr1 C T 7: 29,101,933 G802D probably damaging Het
Shroom3 T C 5: 92,943,071 S1146P probably damaging Het
Stam T C 2: 14,129,173 probably null Het
Vmn2r100 A G 17: 19,531,563 M623V probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Xkr7 T C 2: 153,032,213 F67L probably damaging Het
Zfp451 A T 1: 33,802,982 probably benign Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp974 A T 7: 27,910,886 H471Q possibly damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTTACACTGTGGTGG -3'
(R):5'- GGTATCAGATGAGCTGGACTC -3'

Sequencing Primer
(F):5'- CTCCTTACACTGTGGTGGGATGAG -3'
(R):5'- AGATGAGCTGGACTCTGCCTG -3'
Posted On 2021-08-31