Incidental Mutation 'R8939:Spen'
ID 680833
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141467890-141538597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141475658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1886 (E1886G)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: E1863G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: E1863G

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105786
AA Change: E1886G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: E1886G

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Meta Mutation Damage Score 0.1442 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,385,061 A32T probably damaging Het
4930578I06Rik A G 14: 63,987,713 V12A probably benign Het
Abcc12 A G 8: 86,517,318 Y1069H probably damaging Het
Abcc9 T C 6: 142,679,251 T473A probably damaging Het
Acsm1 A T 7: 119,640,645 T271S probably benign Het
Adh6b T C 3: 138,349,636 I49T probably benign Het
Aff4 A T 11: 53,372,404 T84S probably benign Het
Angptl7 G A 4: 148,496,499 R280* probably null Het
Bhlhe23 T A 2: 180,776,306 K146N probably damaging Het
Cacna1s T C 1: 136,086,806 probably null Het
Cfap45 C G 1: 172,545,267 R510G probably damaging Het
Chl1 A G 6: 103,665,907 Y202C probably damaging Het
Chrna6 T A 8: 27,406,842 T336S probably benign Het
Clpx A G 9: 65,324,237 K535E probably benign Het
Crybg3 T C 16: 59,556,149 M1581V probably benign Het
Ddx4 A T 13: 112,622,289 I246K probably benign Het
F7 G T 8: 13,028,724 G52C probably damaging Het
Fam186b T C 15: 99,279,342 Q701R probably benign Het
Fign T A 2: 63,979,112 M605L probably benign Het
Fpr2 T C 17: 17,893,621 F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gria2 A T 3: 80,710,863 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsto2 T C 19: 47,884,764 probably null Het
Hsd3b1 A G 3: 98,852,983 W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,567,463 probably null Het
Ighv1-80 C T 12: 115,912,493 G68R probably damaging Het
Il10ra A G 9: 45,266,504 V69A unknown Het
Klhdc1 C T 12: 69,253,763 A159V probably damaging Het
Krtap4-6 A G 11: 99,665,403 I166T unknown Het
Lce1h A T 3: 92,763,669 C59S unknown Het
Magi3 T C 3: 104,089,432 probably benign Het
Map3k1 G T 13: 111,756,303 S806* probably null Het
Map3k6 T A 4: 133,252,643 probably benign Het
Mgam G A 6: 40,763,203 probably null Het
Mtx1 A G 3: 89,212,726 V207A probably damaging Het
Muc5ac A T 7: 141,793,354 N356Y probably damaging Het
Myo16 T C 8: 10,474,679 F810S probably damaging Het
Nlrx1 A G 9: 44,255,464 L774P probably damaging Het
Nr1i2 C T 16: 38,266,020 V28I probably benign Het
Olfr1484 A C 19: 13,585,496 N64T probably damaging Het
Olfr63 A G 17: 33,269,615 K297R probably damaging Het
Pcmtd2 T C 2: 181,855,070 probably benign Het
Pcnx3 A G 19: 5,680,319 L102P probably damaging Het
Pnpla6 A G 8: 3,521,319 E114G possibly damaging Het
Ppp4r1 T C 17: 65,803,931 V70A probably damaging Het
Psd2 G A 18: 35,988,239 V421M probably damaging Het
Rbak C T 5: 143,174,270 E343K possibly damaging Het
Rhbdf1 G A 11: 32,210,093 A136V probably benign Het
Rusc1 T A 3: 89,088,030 E231D probably benign Het
Rxfp1 T C 3: 79,644,924 E690G probably damaging Het
Sdr9c7 A G 10: 127,898,907 E88G probably benign Het
Sec23b T C 2: 144,569,217 probably null Het
Sgcb A T 5: 73,644,318 I68N probably damaging Het
Sh3pxd2b T C 11: 32,414,433 probably benign Het
Slc25a48 C T 13: 56,463,706 P209S probably damaging Het
Slc9a3 C A 13: 74,163,776 H614Q possibly damaging Het
Slurp1 G A 15: 74,726,914 S76L probably damaging Het
Sqor C T 2: 122,807,629 P151S possibly damaging Het
Sstr4 C A 2: 148,396,308 L280M probably damaging Het
Stard10 A G 7: 101,342,640 Y117C probably damaging Het
Stard13 A T 5: 151,045,109 probably null Het
Stim2 G T 5: 54,105,331 R305L possibly damaging Het
Syt14 G A 1: 192,930,588 R635C probably damaging Het
Tmcc3 A T 10: 94,545,621 probably benign Het
Ttn T C 2: 76,745,351 N23320S possibly damaging Het
Ubqln4 A G 3: 88,565,716 T493A probably benign Het
Ugt2b34 A G 5: 86,891,299 L501P probably damaging Het
Umod T C 7: 119,469,477 I449V probably damaging Het
Vmn2r51 C A 7: 10,100,026 D362Y possibly damaging Het
Xirp2 A C 2: 67,516,144 T2910P probably benign Het
Zscan20 A G 4: 128,604,522 S28P probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
filtered UTSW 4 141477372 missense unknown
mentholated UTSW 4 141469400 missense possibly damaging 0.78
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
R8159:Spen UTSW 4 141475003 missense possibly damaging 0.53
R8187:Spen UTSW 4 141472905 missense possibly damaging 0.93
R8463:Spen UTSW 4 141522279 missense unknown
R8557:Spen UTSW 4 141470370 missense probably benign 0.14
R8558:Spen UTSW 4 141470370 missense probably benign 0.14
R8672:Spen UTSW 4 141470370 missense probably benign 0.14
R8673:Spen UTSW 4 141470370 missense probably benign 0.14
R8674:Spen UTSW 4 141470370 missense probably benign 0.14
R8714:Spen UTSW 4 141488003 missense unknown
R8735:Spen UTSW 4 141469818 missense probably benign 0.32
R8762:Spen UTSW 4 141472950 missense probably damaging 1.00
R8877:Spen UTSW 4 141471826 nonsense probably null
R8878:Spen UTSW 4 141477209 missense unknown
R8937:Spen UTSW 4 141474063 missense probably damaging 1.00
R8968:Spen UTSW 4 141470390 missense probably benign 0.02
R8971:Spen UTSW 4 141474578 missense possibly damaging 0.53
R9016:Spen UTSW 4 141473627 missense probably damaging 1.00
R9072:Spen UTSW 4 141476391 missense unknown
R9073:Spen UTSW 4 141476391 missense unknown
R9120:Spen UTSW 4 141472922 missense
R9136:Spen UTSW 4 141522312 missense unknown
R9138:Spen UTSW 4 141469486 missense probably damaging 1.00
R9150:Spen UTSW 4 141517157 missense unknown
R9225:Spen UTSW 4 141475632 missense possibly damaging 0.53
R9492:Spen UTSW 4 141471787 missense probably benign 0.26
R9537:Spen UTSW 4 141471704 missense probably benign 0.15
R9537:Spen UTSW 4 141516845 small deletion probably benign
R9602:Spen UTSW 4 141477872 missense unknown
R9609:Spen UTSW 4 141488108 missense unknown
R9686:Spen UTSW 4 141472635 missense probably benign 0.27
R9697:Spen UTSW 4 141468964 missense probably damaging 1.00
R9713:Spen UTSW 4 141517020 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTCTGAGACCTCGGTGAC -3'
(R):5'- CAGTCGCTGCAAAAGACAGG -3'

Sequencing Primer
(F):5'- TCCTGGTCACTCTGGGCTG -3'
(R):5'- GAAGACTAACAAGAGCAAGCGTTCC -3'
Posted On 2021-08-31