Incidental Mutation 'R8939:Stard13'
ID 680839
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene Name StAR-related lipid transfer (START) domain containing 13
Synonyms GT650, DLC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 151037510-151233836 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 151045109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000202111]
AlphaFold Q923Q2
Predicted Effect probably null
Transcript: ENSMUST00000062015
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110483
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,385,061 A32T probably damaging Het
4930578I06Rik A G 14: 63,987,713 V12A probably benign Het
Abcc12 A G 8: 86,517,318 Y1069H probably damaging Het
Abcc9 T C 6: 142,679,251 T473A probably damaging Het
Acsm1 A T 7: 119,640,645 T271S probably benign Het
Adh6b T C 3: 138,349,636 I49T probably benign Het
Aff4 A T 11: 53,372,404 T84S probably benign Het
Angptl7 G A 4: 148,496,499 R280* probably null Het
Bhlhe23 T A 2: 180,776,306 K146N probably damaging Het
Cacna1s T C 1: 136,086,806 probably null Het
Cfap45 C G 1: 172,545,267 R510G probably damaging Het
Chl1 A G 6: 103,665,907 Y202C probably damaging Het
Chrna6 T A 8: 27,406,842 T336S probably benign Het
Clpx A G 9: 65,324,237 K535E probably benign Het
Crybg3 T C 16: 59,556,149 M1581V probably benign Het
Ddx4 A T 13: 112,622,289 I246K probably benign Het
F7 G T 8: 13,028,724 G52C probably damaging Het
Fam186b T C 15: 99,279,342 Q701R probably benign Het
Fign T A 2: 63,979,112 M605L probably benign Het
Fpr2 T C 17: 17,893,621 F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gria2 A T 3: 80,710,863 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsto2 T C 19: 47,884,764 probably null Het
Hsd3b1 A G 3: 98,852,983 W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,567,463 probably null Het
Ighv1-80 C T 12: 115,912,493 G68R probably damaging Het
Il10ra A G 9: 45,266,504 V69A unknown Het
Klhdc1 C T 12: 69,253,763 A159V probably damaging Het
Krtap4-6 A G 11: 99,665,403 I166T unknown Het
Lce1h A T 3: 92,763,669 C59S unknown Het
Magi3 T C 3: 104,089,432 probably benign Het
Map3k1 G T 13: 111,756,303 S806* probably null Het
Map3k6 T A 4: 133,252,643 probably benign Het
Mgam G A 6: 40,763,203 probably null Het
Mtx1 A G 3: 89,212,726 V207A probably damaging Het
Muc5ac A T 7: 141,793,354 N356Y probably damaging Het
Myo16 T C 8: 10,474,679 F810S probably damaging Het
Nlrx1 A G 9: 44,255,464 L774P probably damaging Het
Nr1i2 C T 16: 38,266,020 V28I probably benign Het
Olfr1484 A C 19: 13,585,496 N64T probably damaging Het
Olfr63 A G 17: 33,269,615 K297R probably damaging Het
Pcmtd2 T C 2: 181,855,070 probably benign Het
Pcnx3 A G 19: 5,680,319 L102P probably damaging Het
Pnpla6 A G 8: 3,521,319 E114G possibly damaging Het
Ppp4r1 T C 17: 65,803,931 V70A probably damaging Het
Psd2 G A 18: 35,988,239 V421M probably damaging Het
Rbak C T 5: 143,174,270 E343K possibly damaging Het
Rhbdf1 G A 11: 32,210,093 A136V probably benign Het
Rusc1 T A 3: 89,088,030 E231D probably benign Het
Rxfp1 T C 3: 79,644,924 E690G probably damaging Het
Sdr9c7 A G 10: 127,898,907 E88G probably benign Het
Sec23b T C 2: 144,569,217 probably null Het
Sgcb A T 5: 73,644,318 I68N probably damaging Het
Sh3pxd2b T C 11: 32,414,433 probably benign Het
Slc25a48 C T 13: 56,463,706 P209S probably damaging Het
Slc9a3 C A 13: 74,163,776 H614Q possibly damaging Het
Slurp1 G A 15: 74,726,914 S76L probably damaging Het
Spen T C 4: 141,475,658 E1886G possibly damaging Het
Sqor C T 2: 122,807,629 P151S possibly damaging Het
Sstr4 C A 2: 148,396,308 L280M probably damaging Het
Stard10 A G 7: 101,342,640 Y117C probably damaging Het
Stim2 G T 5: 54,105,331 R305L possibly damaging Het
Syt14 G A 1: 192,930,588 R635C probably damaging Het
Tmcc3 A T 10: 94,545,621 probably benign Het
Ttn T C 2: 76,745,351 N23320S possibly damaging Het
Ubqln4 A G 3: 88,565,716 T493A probably benign Het
Ugt2b34 A G 5: 86,891,299 L501P probably damaging Het
Umod T C 7: 119,469,477 I449V probably damaging Het
Vmn2r51 C A 7: 10,100,026 D362Y possibly damaging Het
Xirp2 A C 2: 67,516,144 T2910P probably benign Het
Zscan20 A G 4: 128,604,522 S28P probably benign Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
R7252:Stard13 UTSW 5 151063169 missense probably benign 0.01
R7318:Stard13 UTSW 5 151062573 nonsense probably null
R7459:Stard13 UTSW 5 151047599 missense probably damaging 1.00
R7571:Stard13 UTSW 5 151059502 missense probably damaging 0.97
R7696:Stard13 UTSW 5 151060802 missense probably damaging 0.99
R7809:Stard13 UTSW 5 151190024 missense probably damaging 0.98
R7962:Stard13 UTSW 5 151052373 missense probably damaging 0.99
R7970:Stard13 UTSW 5 151063261 missense possibly damaging 0.83
R8103:Stard13 UTSW 5 151046970 missense possibly damaging 0.92
R8113:Stard13 UTSW 5 151063505 missense probably damaging 0.99
R8263:Stard13 UTSW 5 151233641 missense possibly damaging 0.81
R8392:Stard13 UTSW 5 151042162 missense probably benign 0.24
R8490:Stard13 UTSW 5 151063625 missense probably damaging 1.00
R8726:Stard13 UTSW 5 151063142 missense probably benign 0.28
R8896:Stard13 UTSW 5 151062650 missense probably damaging 1.00
R8946:Stard13 UTSW 5 151060802 missense probably damaging 1.00
R9157:Stard13 UTSW 5 151233687 missense probably benign 0.00
R9257:Stard13 UTSW 5 151062491 missense probably benign
R9387:Stard13 UTSW 5 151190018 missense probably benign 0.27
R9586:Stard13 UTSW 5 151062367 missense possibly damaging 0.90
Z1177:Stard13 UTSW 5 151063334 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCTAATCAACTGTGCACCTTG -3'
(R):5'- GAAGCTGTGGAAAGCATCTG -3'

Sequencing Primer
(F):5'- CTAATCAACTGTGCACCTTGAGGAG -3'
(R):5'- CTGTGGAAAGCATCTGTGGAG -3'
Posted On 2021-08-31