Incidental Mutation 'R8939:Vmn2r51'
ID 680843
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 068712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9833953 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 362 (D362Y)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect possibly damaging
Transcript: ENSMUST00000094863
AA Change: D362Y

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: D362Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 64,225,162 (GRCm39) V12A probably benign Het
Abcc12 A G 8: 87,243,947 (GRCm39) Y1069H probably damaging Het
Abcc9 T C 6: 142,624,977 (GRCm39) T473A probably damaging Het
Acsm1 A T 7: 119,239,868 (GRCm39) T271S probably benign Het
Adh6b T C 3: 138,055,397 (GRCm39) I49T probably benign Het
Aff4 A T 11: 53,263,231 (GRCm39) T84S probably benign Het
Angptl7 G A 4: 148,580,956 (GRCm39) R280* probably null Het
Bhlhe23 T A 2: 180,418,099 (GRCm39) K146N probably damaging Het
Cacna1s T C 1: 136,014,544 (GRCm39) probably null Het
Cfap45 C G 1: 172,372,834 (GRCm39) R510G probably damaging Het
Chl1 A G 6: 103,642,868 (GRCm39) Y202C probably damaging Het
Chrna6 T A 8: 27,896,870 (GRCm39) T336S probably benign Het
Clpx A G 9: 65,231,519 (GRCm39) K535E probably benign Het
Crybg3 T C 16: 59,376,512 (GRCm39) M1581V probably benign Het
Ddx4 A T 13: 112,758,823 (GRCm39) I246K probably benign Het
F7 G T 8: 13,078,724 (GRCm39) G52C probably damaging Het
Fam186b T C 15: 99,177,223 (GRCm39) Q701R probably benign Het
Fign T A 2: 63,809,456 (GRCm39) M605L probably benign Het
Fpr2 T C 17: 18,113,883 (GRCm39) F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 141,794,171 (GRCm39) probably benign Het
Gria2 A T 3: 80,618,170 (GRCm39) probably benign Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Gsto2 T C 19: 47,873,203 (GRCm39) probably null Het
Hsd3b1 A G 3: 98,760,299 (GRCm39) W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,266,888 (GRCm39) probably null Het
Ighv1-80 C T 12: 115,876,113 (GRCm39) G68R probably damaging Het
Il10ra A G 9: 45,177,802 (GRCm39) V69A unknown Het
Klhdc1 C T 12: 69,300,537 (GRCm39) A159V probably damaging Het
Krtap4-6 A G 11: 99,556,229 (GRCm39) I166T unknown Het
Lce1h A T 3: 92,670,976 (GRCm39) C59S unknown Het
Magi3 T C 3: 103,996,748 (GRCm39) probably benign Het
Map3k1 G T 13: 111,892,837 (GRCm39) S806* probably null Het
Map3k6 T A 4: 132,979,954 (GRCm39) probably benign Het
Mgam G A 6: 40,740,137 (GRCm39) probably null Het
Mtx1 A G 3: 89,120,033 (GRCm39) V207A probably damaging Het
Muc5ac A T 7: 141,347,091 (GRCm39) N356Y probably damaging Het
Myo16 T C 8: 10,524,679 (GRCm39) F810S probably damaging Het
Nlrx1 A G 9: 44,166,761 (GRCm39) L774P probably damaging Het
Nr1i2 C T 16: 38,086,382 (GRCm39) V28I probably benign Het
Or10h28 A G 17: 33,488,589 (GRCm39) K297R probably damaging Het
Or5b122 A C 19: 13,562,860 (GRCm39) N64T probably damaging Het
Pcmtd2 T C 2: 181,496,863 (GRCm39) probably benign Het
Pcnx3 A G 19: 5,730,347 (GRCm39) L102P probably damaging Het
Pnpla6 A G 8: 3,571,319 (GRCm39) E114G possibly damaging Het
Ppp4r1 T C 17: 66,110,926 (GRCm39) V70A probably damaging Het
Psd2 G A 18: 36,121,292 (GRCm39) V421M probably damaging Het
Qng1 C T 13: 58,532,875 (GRCm39) A32T probably damaging Het
Rbak C T 5: 143,160,025 (GRCm39) E343K possibly damaging Het
Rhbdf1 G A 11: 32,160,093 (GRCm39) A136V probably benign Het
Rusc1 T A 3: 88,995,337 (GRCm39) E231D probably benign Het
Rxfp1 T C 3: 79,552,231 (GRCm39) E690G probably damaging Het
Sdr9c7 A G 10: 127,734,776 (GRCm39) E88G probably benign Het
Sec23b T C 2: 144,411,137 (GRCm39) probably null Het
Sgcb A T 5: 73,801,661 (GRCm39) I68N probably damaging Het
Sh3pxd2b T C 11: 32,364,433 (GRCm39) probably benign Het
Slc25a48 C T 13: 56,611,519 (GRCm39) P209S probably damaging Het
Slc9a3 C A 13: 74,311,895 (GRCm39) H614Q possibly damaging Het
Slurp1 G A 15: 74,598,763 (GRCm39) S76L probably damaging Het
Spen T C 4: 141,202,969 (GRCm39) E1886G possibly damaging Het
Sqor C T 2: 122,649,549 (GRCm39) P151S possibly damaging Het
Sstr4 C A 2: 148,238,228 (GRCm39) L280M probably damaging Het
Stard10 A G 7: 100,991,847 (GRCm39) Y117C probably damaging Het
Stard13 A T 5: 150,968,574 (GRCm39) probably null Het
Stim2 G T 5: 54,262,673 (GRCm39) R305L possibly damaging Het
Syt14 G A 1: 192,612,896 (GRCm39) R635C probably damaging Het
Tmcc3 A T 10: 94,381,483 (GRCm39) probably benign Het
Ttn T C 2: 76,575,695 (GRCm39) N23320S possibly damaging Het
Ubqln4 A G 3: 88,473,023 (GRCm39) T493A probably benign Het
Ugt2b34 A G 5: 87,039,158 (GRCm39) L501P probably damaging Het
Umod T C 7: 119,068,700 (GRCm39) I449V probably damaging Het
Xirp2 A C 2: 67,346,488 (GRCm39) T2910P probably benign Het
Zscan20 A G 4: 128,498,315 (GRCm39) S28P probably benign Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGCCTGTTGCAGATTCATC -3'
(R):5'- TCAGAATGTTGGACCCTCCCAC -3'

Sequencing Primer
(F):5'- CAGATTCATCTCGTGGAGGGC -3'
(R):5'- CTCCCACTTTACAGAGAATATGGATC -3'
Posted On 2021-08-31