Incidental Mutation 'R8939:Aff4'
ID 680859
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53372404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 84 (T84S)
Ref Sequence ENSEMBL: ENSMUSP00000120613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945] [ENSMUST00000153821]
AlphaFold Q9ESC8
Predicted Effect probably benign
Transcript: ENSMUST00000060945
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: T84S

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153821
AA Change: T84S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120613
Gene: ENSMUSG00000049470
AA Change: T84S

DomainStartEndE-ValueType
Pfam:AF-4 2 122 4.1e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,385,061 A32T probably damaging Het
4930578I06Rik A G 14: 63,987,713 V12A probably benign Het
Abcc12 A G 8: 86,517,318 Y1069H probably damaging Het
Abcc9 T C 6: 142,679,251 T473A probably damaging Het
Acsm1 A T 7: 119,640,645 T271S probably benign Het
Adh6b T C 3: 138,349,636 I49T probably benign Het
Angptl7 G A 4: 148,496,499 R280* probably null Het
Bhlhe23 T A 2: 180,776,306 K146N probably damaging Het
Cacna1s T C 1: 136,086,806 probably null Het
Cfap45 C G 1: 172,545,267 R510G probably damaging Het
Chl1 A G 6: 103,665,907 Y202C probably damaging Het
Chrna6 T A 8: 27,406,842 T336S probably benign Het
Clpx A G 9: 65,324,237 K535E probably benign Het
Crybg3 T C 16: 59,556,149 M1581V probably benign Het
Ddx4 A T 13: 112,622,289 I246K probably benign Het
F7 G T 8: 13,028,724 G52C probably damaging Het
Fam186b T C 15: 99,279,342 Q701R probably benign Het
Fign T A 2: 63,979,112 M605L probably benign Het
Fpr2 T C 17: 17,893,621 F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gria2 A T 3: 80,710,863 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsto2 T C 19: 47,884,764 probably null Het
Hsd3b1 A G 3: 98,852,983 W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,567,463 probably null Het
Ighv1-80 C T 12: 115,912,493 G68R probably damaging Het
Il10ra A G 9: 45,266,504 V69A unknown Het
Klhdc1 C T 12: 69,253,763 A159V probably damaging Het
Krtap4-6 A G 11: 99,665,403 I166T unknown Het
Lce1h A T 3: 92,763,669 C59S unknown Het
Magi3 T C 3: 104,089,432 probably benign Het
Map3k1 G T 13: 111,756,303 S806* probably null Het
Map3k6 T A 4: 133,252,643 probably benign Het
Mgam G A 6: 40,763,203 probably null Het
Mtx1 A G 3: 89,212,726 V207A probably damaging Het
Muc5ac A T 7: 141,793,354 N356Y probably damaging Het
Myo16 T C 8: 10,474,679 F810S probably damaging Het
Nlrx1 A G 9: 44,255,464 L774P probably damaging Het
Nr1i2 C T 16: 38,266,020 V28I probably benign Het
Olfr1484 A C 19: 13,585,496 N64T probably damaging Het
Olfr63 A G 17: 33,269,615 K297R probably damaging Het
Pcmtd2 T C 2: 181,855,070 probably benign Het
Pcnx3 A G 19: 5,680,319 L102P probably damaging Het
Pnpla6 A G 8: 3,521,319 E114G possibly damaging Het
Ppp4r1 T C 17: 65,803,931 V70A probably damaging Het
Psd2 G A 18: 35,988,239 V421M probably damaging Het
Rbak C T 5: 143,174,270 E343K possibly damaging Het
Rhbdf1 G A 11: 32,210,093 A136V probably benign Het
Rusc1 T A 3: 89,088,030 E231D probably benign Het
Rxfp1 T C 3: 79,644,924 E690G probably damaging Het
Sdr9c7 A G 10: 127,898,907 E88G probably benign Het
Sec23b T C 2: 144,569,217 probably null Het
Sgcb A T 5: 73,644,318 I68N probably damaging Het
Sh3pxd2b T C 11: 32,414,433 probably benign Het
Slc25a48 C T 13: 56,463,706 P209S probably damaging Het
Slc9a3 C A 13: 74,163,776 H614Q possibly damaging Het
Slurp1 G A 15: 74,726,914 S76L probably damaging Het
Spen T C 4: 141,475,658 E1886G possibly damaging Het
Sqor C T 2: 122,807,629 P151S possibly damaging Het
Sstr4 C A 2: 148,396,308 L280M probably damaging Het
Stard10 A G 7: 101,342,640 Y117C probably damaging Het
Stard13 A T 5: 151,045,109 probably null Het
Stim2 G T 5: 54,105,331 R305L possibly damaging Het
Syt14 G A 1: 192,930,588 R635C probably damaging Het
Tmcc3 A T 10: 94,545,621 probably benign Het
Ttn T C 2: 76,745,351 N23320S possibly damaging Het
Ubqln4 A G 3: 88,565,716 T493A probably benign Het
Ugt2b34 A G 5: 86,891,299 L501P probably damaging Het
Umod T C 7: 119,469,477 I449V probably damaging Het
Vmn2r51 C A 7: 10,100,026 D362Y possibly damaging Het
Xirp2 A C 2: 67,516,144 T2910P probably benign Het
Zscan20 A G 4: 128,604,522 S28P probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCAGCGTGTAAACGGTTCTAG -3'
(R):5'- TGCTACTGCTGTAGGAGTCAC -3'

Sequencing Primer
(F):5'- TGGTGTGTGTGTGTATGTATATTTAG -3'
(R):5'- CTGTAGGAGTCACGGTCATGC -3'
Posted On 2021-08-31