Incidental Mutation 'R8939:Slc9a3'
ID 680865
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 74163776 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 614 (H614Q)
Ref Sequence ENSEMBL: ENSMUSP00000152682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect possibly damaging
Transcript: ENSMUST00000036208
AA Change: H614Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: H614Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221703
AA Change: H614Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect
Meta Mutation Damage Score 0.1838 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,385,061 A32T probably damaging Het
4930578I06Rik A G 14: 63,987,713 V12A probably benign Het
Abcc12 A G 8: 86,517,318 Y1069H probably damaging Het
Abcc9 T C 6: 142,679,251 T473A probably damaging Het
Acsm1 A T 7: 119,640,645 T271S probably benign Het
Adh6b T C 3: 138,349,636 I49T probably benign Het
Aff4 A T 11: 53,372,404 T84S probably benign Het
Angptl7 G A 4: 148,496,499 R280* probably null Het
Bhlhe23 T A 2: 180,776,306 K146N probably damaging Het
Cacna1s T C 1: 136,086,806 probably null Het
Cfap45 C G 1: 172,545,267 R510G probably damaging Het
Chl1 A G 6: 103,665,907 Y202C probably damaging Het
Chrna6 T A 8: 27,406,842 T336S probably benign Het
Clpx A G 9: 65,324,237 K535E probably benign Het
Crybg3 T C 16: 59,556,149 M1581V probably benign Het
Ddx4 A T 13: 112,622,289 I246K probably benign Het
F7 G T 8: 13,028,724 G52C probably damaging Het
Fam186b T C 15: 99,279,342 Q701R probably benign Het
Fign T A 2: 63,979,112 M605L probably benign Het
Fpr2 T C 17: 17,893,621 F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gria2 A T 3: 80,710,863 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsto2 T C 19: 47,884,764 probably null Het
Hsd3b1 A G 3: 98,852,983 W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,567,463 probably null Het
Ighv1-80 C T 12: 115,912,493 G68R probably damaging Het
Il10ra A G 9: 45,266,504 V69A unknown Het
Klhdc1 C T 12: 69,253,763 A159V probably damaging Het
Krtap4-6 A G 11: 99,665,403 I166T unknown Het
Lce1h A T 3: 92,763,669 C59S unknown Het
Magi3 T C 3: 104,089,432 probably benign Het
Map3k1 G T 13: 111,756,303 S806* probably null Het
Map3k6 T A 4: 133,252,643 probably benign Het
Mgam G A 6: 40,763,203 probably null Het
Mtx1 A G 3: 89,212,726 V207A probably damaging Het
Muc5ac A T 7: 141,793,354 N356Y probably damaging Het
Myo16 T C 8: 10,474,679 F810S probably damaging Het
Nlrx1 A G 9: 44,255,464 L774P probably damaging Het
Nr1i2 C T 16: 38,266,020 V28I probably benign Het
Olfr1484 A C 19: 13,585,496 N64T probably damaging Het
Olfr63 A G 17: 33,269,615 K297R probably damaging Het
Pcmtd2 T C 2: 181,855,070 probably benign Het
Pcnx3 A G 19: 5,680,319 L102P probably damaging Het
Pnpla6 A G 8: 3,521,319 E114G possibly damaging Het
Ppp4r1 T C 17: 65,803,931 V70A probably damaging Het
Psd2 G A 18: 35,988,239 V421M probably damaging Het
Rbak C T 5: 143,174,270 E343K possibly damaging Het
Rhbdf1 G A 11: 32,210,093 A136V probably benign Het
Rusc1 T A 3: 89,088,030 E231D probably benign Het
Rxfp1 T C 3: 79,644,924 E690G probably damaging Het
Sdr9c7 A G 10: 127,898,907 E88G probably benign Het
Sec23b T C 2: 144,569,217 probably null Het
Sgcb A T 5: 73,644,318 I68N probably damaging Het
Sh3pxd2b T C 11: 32,414,433 probably benign Het
Slc25a48 C T 13: 56,463,706 P209S probably damaging Het
Slurp1 G A 15: 74,726,914 S76L probably damaging Het
Spen T C 4: 141,475,658 E1886G possibly damaging Het
Sqor C T 2: 122,807,629 P151S possibly damaging Het
Sstr4 C A 2: 148,396,308 L280M probably damaging Het
Stard10 A G 7: 101,342,640 Y117C probably damaging Het
Stard13 A T 5: 151,045,109 probably null Het
Stim2 G T 5: 54,105,331 R305L possibly damaging Het
Syt14 G A 1: 192,930,588 R635C probably damaging Het
Tmcc3 A T 10: 94,545,621 probably benign Het
Ttn T C 2: 76,745,351 N23320S possibly damaging Het
Ubqln4 A G 3: 88,565,716 T493A probably benign Het
Ugt2b34 A G 5: 86,891,299 L501P probably damaging Het
Umod T C 7: 119,469,477 I449V probably damaging Het
Vmn2r51 C A 7: 10,100,026 D362Y possibly damaging Het
Xirp2 A C 2: 67,516,144 T2910P probably benign Het
Zscan20 A G 4: 128,604,522 S28P probably benign Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATCCAAGCAGTCCTGAG -3'
(R):5'- TGTGACTGGGTTTCACTAGCC -3'

Sequencing Primer
(F):5'- CTGAGGCAGGAAGGGACTATG -3'
(R):5'- ACTAGCCATCCCTGTGGAC -3'
Posted On 2021-08-31