Incidental Mutation 'R8940:Setdb2'
ID 680938
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.510) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 59402009-59440884 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59409507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 536 (S536P)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: S536P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: S536P

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161459
AA Change: S520P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: S520P

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Meta Mutation Damage Score 0.3969 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,093,202 S1709T probably benign Het
Abcc12 A G 8: 86,560,811 V135A probably benign Het
Alkbh3 G T 2: 94,008,046 P60H probably damaging Het
Armc3 A C 2: 19,235,582 Y50S probably damaging Het
Arpc4 T C 6: 113,385,638 V70A probably benign Het
Atp13a4 A G 16: 29,454,690 probably null Het
Bco1 A T 8: 117,130,608 Y438F probably benign Het
Cacna1b C A 2: 24,763,072 probably benign Het
Cdh17 C T 4: 11,783,226 S189L probably damaging Het
Cltc T C 11: 86,730,246 T312A probably benign Het
Crym T A 7: 120,195,480 N172I probably benign Het
Depdc7 A G 2: 104,724,568 probably null Het
Dnhd1 T A 7: 105,714,647 probably benign Het
Dntt T A 19: 41,058,551 probably benign Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Fat2 A T 11: 55,256,810 L3869M possibly damaging Het
Garnl3 T C 2: 33,005,229 probably null Het
Gldc C T 19: 30,151,484 M196I probably benign Het
Gm17078 C T 14: 51,608,885 V120M probably damaging Het
Gm5157 G A 7: 21,184,760 S286F probably damaging Het
Gm6337 C T 14: 6,055,308 C187Y probably damaging Het
Gm9833 A T 3: 10,088,346 L58F probably benign Het
Golgb1 A G 16: 36,916,397 D2002G probably damaging Het
Gpr179 T C 11: 97,337,849 N1160S probably damaging Het
Gulo A G 14: 65,997,591 V227A probably benign Het
Hlcs G A 16: 94,231,226 A31V probably benign Het
Hs1bp3 T C 12: 8,341,980 S361P probably benign Het
Ifi44 G A 3: 151,749,309 P93L probably benign Het
Izumo2 T A 7: 44,713,046 M78K probably benign Het
Lin54 T C 5: 100,446,671 E545G probably damaging Het
Map3k13 A T 16: 21,908,704 I439F possibly damaging Het
Matr3 T G 18: 35,572,587 S188R probably damaging Het
Mug1 A T 6: 121,881,683 H1120L Het
Ndst4 A G 3: 125,681,153 probably benign Het
Nlrp3 G A 11: 59,565,044 V889M probably benign Het
Olfr1030 A T 2: 85,984,199 M120L probably benign Het
Olfr1375 A G 11: 51,048,628 I174V probably benign Het
Olfr456 A G 6: 42,486,278 M305T probably benign Het
Olfr985 T A 9: 40,127,184 Y259F probably damaging Het
Olfr998 A G 2: 85,591,184 I215V probably benign Het
P4hb A T 11: 120,568,002 D182E probably benign Het
Pcdh10 A G 3: 45,384,185 T926A possibly damaging Het
Pikfyve T C 1: 65,246,970 S1078P probably benign Het
Plcl2 A T 17: 50,608,762 D933V probably damaging Het
Pramel7 G A 2: 87,491,268 T141I probably benign Het
Prepl A T 17: 85,068,926 C567S probably damaging Het
Prpsap1 A T 11: 116,479,789 M114K probably damaging Het
Ptk2b A C 14: 66,170,236 probably null Het
Rest T C 5: 77,282,868 F1045L possibly damaging Het
Rnf19a A G 15: 36,260,138 C254R probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,579,906 probably benign Het
Setdb1 T A 3: 95,356,172 M8L probably benign Het
Sipa1l1 T C 12: 82,357,266 L511P probably damaging Het
Slc12a9 T A 5: 137,328,493 H234L probably benign Het
Slc35e2 G T 4: 155,610,085 G30W probably damaging Het
Slc6a15 T C 10: 103,393,496 V132A probably damaging Het
Slc7a10 A G 7: 35,200,450 T486A probably benign Het
Smc5 T C 19: 23,259,762 Y235C probably benign Het
Sorcs3 T C 19: 48,796,469 probably null Het
Spata21 T C 4: 141,104,905 L459P probably damaging Het
Tbc1d9 A G 8: 83,254,823 I706M probably damaging Het
Tcp11 T A 17: 28,080,230 E17V probably damaging Het
Tiparp A G 3: 65,531,878 D23G probably benign Het
Tmem108 A G 9: 103,499,957 S98P possibly damaging Het
Tmem35b A G 4: 127,127,880 D56G probably damaging Het
Tnr G C 1: 159,858,297 G366A probably damaging Het
Ttc3 A G 16: 94,429,499 S852G possibly damaging Het
Ttn G A 2: 76,766,594 L19992F probably damaging Het
Ush2a T A 1: 188,400,308 M909K probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wif1 A G 10: 121,099,779 H333R probably benign Het
Zfp119a A G 17: 55,865,551 C431R probably damaging Het
Zfp345 G A 2: 150,472,357 P420L probably benign Het
Zfp608 C T 18: 54,900,229 D411N possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp74 A G 7: 29,935,347 V312A possibly damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8513:Setdb2 UTSW 14 59402390 missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59417439 missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59423458 nonsense probably null
R9217:Setdb2 UTSW 14 59409432 missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59412791 missense probably benign 0.02
R9336:Setdb2 UTSW 14 59423367 missense unknown
R9442:Setdb2 UTSW 14 59402400 missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59409392 missense probably benign 0.00
R9743:Setdb2 UTSW 14 59413553 missense probably benign 0.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGACTTCTTTCCTGGGAC -3'
(R):5'- TTCGAAGCTGGGCACATATG -3'

Sequencing Primer
(F):5'- CTGGGACTTCAAGCACCTGTTTAG -3'
(R):5'- GAGTCAGGTAAATCTAAGTCCTCCAG -3'
Posted On 2021-08-31