Incidental Mutation 'R8940:Map3k13'
ID 680942
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 068780-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21727454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 439 (I439F)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: I439F

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: I439F

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180401
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: I439F

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: I439F

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,241,068 (GRCm39) S1709T probably benign Het
Abcc12 A G 8: 87,287,440 (GRCm39) V135A probably benign Het
Alkbh3 G T 2: 93,838,391 (GRCm39) P60H probably damaging Het
Armc3 A C 2: 19,240,393 (GRCm39) Y50S probably damaging Het
Arpc4 T C 6: 113,362,599 (GRCm39) V70A probably benign Het
Atp13a4 A G 16: 29,273,508 (GRCm39) probably null Het
Bco1 A T 8: 117,857,347 (GRCm39) Y438F probably benign Het
Cacna1b C A 2: 24,653,084 (GRCm39) probably benign Het
Cdh17 C T 4: 11,783,226 (GRCm39) S189L probably damaging Het
Cltc T C 11: 86,621,072 (GRCm39) T312A probably benign Het
Crym T A 7: 119,794,703 (GRCm39) N172I probably benign Het
Depdc7 A G 2: 104,554,913 (GRCm39) probably null Het
Dnhd1 T A 7: 105,363,854 (GRCm39) probably benign Het
Dntt T A 19: 41,046,990 (GRCm39) probably benign Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Fat2 A T 11: 55,147,636 (GRCm39) L3869M possibly damaging Het
Garnl3 T C 2: 32,895,241 (GRCm39) probably null Het
Gldc C T 19: 30,128,884 (GRCm39) M196I probably benign Het
Gm17078 C T 14: 51,846,342 (GRCm39) V120M probably damaging Het
Gm5157 G A 7: 20,918,685 (GRCm39) S286F probably damaging Het
Gm6337 C T 14: 6,055,308 (GRCm38) C187Y probably damaging Het
Golgb1 A G 16: 36,736,759 (GRCm39) D2002G probably damaging Het
Gpr179 T C 11: 97,228,675 (GRCm39) N1160S probably damaging Het
Gulo A G 14: 66,235,040 (GRCm39) V227A probably benign Het
Hlcs G A 16: 94,032,085 (GRCm39) A31V probably benign Het
Hs1bp3 T C 12: 8,391,980 (GRCm39) S361P probably benign Het
Ifi44 G A 3: 151,454,946 (GRCm39) P93L probably benign Het
Izumo2 T A 7: 44,362,470 (GRCm39) M78K probably benign Het
Lin54 T C 5: 100,594,530 (GRCm39) E545G probably damaging Het
Matr3 T G 18: 35,705,640 (GRCm39) S188R probably damaging Het
Mug1 A T 6: 121,858,642 (GRCm39) H1120L Het
Myef2l A T 3: 10,153,406 (GRCm39) L58F probably benign Het
Ndst4 A G 3: 125,474,802 (GRCm39) probably benign Het
Nlrp3 G A 11: 59,455,870 (GRCm39) V889M probably benign Het
Or1x6 A G 11: 50,939,455 (GRCm39) I174V probably benign Het
Or2r2 A G 6: 42,463,212 (GRCm39) M305T probably benign Het
Or5g29 A G 2: 85,421,528 (GRCm39) I215V probably benign Het
Or5m5 A T 2: 85,814,543 (GRCm39) M120L probably benign Het
Or8d4 T A 9: 40,038,480 (GRCm39) Y259F probably damaging Het
P4hb A T 11: 120,458,828 (GRCm39) D182E probably benign Het
Pcdh10 A G 3: 45,338,620 (GRCm39) T926A possibly damaging Het
Pikfyve T C 1: 65,286,129 (GRCm39) S1078P probably benign Het
Plcl2 A T 17: 50,915,790 (GRCm39) D933V probably damaging Het
Pramel7 G A 2: 87,321,612 (GRCm39) T141I probably benign Het
Prepl A T 17: 85,376,354 (GRCm39) C567S probably damaging Het
Prpsap1 A T 11: 116,370,615 (GRCm39) M114K probably damaging Het
Ptk2b A C 14: 66,407,685 (GRCm39) probably null Het
Rest T C 5: 77,430,715 (GRCm39) F1045L possibly damaging Het
Rnf19a A G 15: 36,260,284 (GRCm39) C254R probably damaging Het
Rrad C T 8: 105,355,222 (GRCm39) R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Setdb1 T A 3: 95,263,483 (GRCm39) M8L probably benign Het
Setdb2 A G 14: 59,646,956 (GRCm39) S536P probably damaging Het
Sipa1l1 T C 12: 82,404,040 (GRCm39) L511P probably damaging Het
Slc12a9 T A 5: 137,326,755 (GRCm39) H234L probably benign Het
Slc35e2 G T 4: 155,694,542 (GRCm39) G30W probably damaging Het
Slc6a15 T C 10: 103,229,357 (GRCm39) V132A probably damaging Het
Slc7a10 A G 7: 34,899,875 (GRCm39) T486A probably benign Het
Smc5 T C 19: 23,237,126 (GRCm39) Y235C probably benign Het
Sorcs3 T C 19: 48,784,908 (GRCm39) probably null Het
Spata21 T C 4: 140,832,216 (GRCm39) L459P probably damaging Het
Tbc1d9 A G 8: 83,981,452 (GRCm39) I706M probably damaging Het
Tcp11 T A 17: 28,299,204 (GRCm39) E17V probably damaging Het
Tiparp A G 3: 65,439,299 (GRCm39) D23G probably benign Het
Tmem108 A G 9: 103,377,156 (GRCm39) S98P possibly damaging Het
Tmem35b A G 4: 127,021,673 (GRCm39) D56G probably damaging Het
Tnr G C 1: 159,685,867 (GRCm39) G366A probably damaging Het
Ttc3 A G 16: 94,230,358 (GRCm39) S852G possibly damaging Het
Ttn G A 2: 76,596,938 (GRCm39) L19992F probably damaging Het
Ush2a T A 1: 188,132,505 (GRCm39) M909K probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wif1 A G 10: 120,935,684 (GRCm39) H333R probably benign Het
Zfp119a A G 17: 56,172,551 (GRCm39) C431R probably damaging Het
Zfp345 G A 2: 150,314,277 (GRCm39) P420L probably benign Het
Zfp608 C T 18: 55,033,301 (GRCm39) D411N possibly damaging Het
Zfp609 C T 9: 65,610,561 (GRCm39) A801T possibly damaging Het
Zfp74 A G 7: 29,634,772 (GRCm39) V312A possibly damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCACTGTGTCAGGAC -3'
(R):5'- AGTGTTCCTGCTCATGTCTG -3'

Sequencing Primer
(F):5'- GGCACTTCTGGCACTCC -3'
(R):5'- CTGCTCATGTCTGAACCTTAGGG -3'
Posted On 2021-08-31