Incidental Mutation 'R8940:Atp13a4'
ID 680943
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29454690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000057018
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably benign
Transcript: ENSMUST00000182627
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,093,202 S1709T probably benign Het
Abcc12 A G 8: 86,560,811 V135A probably benign Het
Alkbh3 G T 2: 94,008,046 P60H probably damaging Het
Armc3 A C 2: 19,235,582 Y50S probably damaging Het
Arpc4 T C 6: 113,385,638 V70A probably benign Het
Bco1 A T 8: 117,130,608 Y438F probably benign Het
Cacna1b C A 2: 24,763,072 probably benign Het
Cdh17 C T 4: 11,783,226 S189L probably damaging Het
Cltc T C 11: 86,730,246 T312A probably benign Het
Crym T A 7: 120,195,480 N172I probably benign Het
Depdc7 A G 2: 104,724,568 probably null Het
Dnhd1 T A 7: 105,714,647 probably benign Het
Dntt T A 19: 41,058,551 probably benign Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Fat2 A T 11: 55,256,810 L3869M possibly damaging Het
Garnl3 T C 2: 33,005,229 probably null Het
Gldc C T 19: 30,151,484 M196I probably benign Het
Gm17078 C T 14: 51,608,885 V120M probably damaging Het
Gm5157 G A 7: 21,184,760 S286F probably damaging Het
Gm6337 C T 14: 6,055,308 C187Y probably damaging Het
Gm9833 A T 3: 10,088,346 L58F probably benign Het
Golgb1 A G 16: 36,916,397 D2002G probably damaging Het
Gpr179 T C 11: 97,337,849 N1160S probably damaging Het
Gulo A G 14: 65,997,591 V227A probably benign Het
Hlcs G A 16: 94,231,226 A31V probably benign Het
Hs1bp3 T C 12: 8,341,980 S361P probably benign Het
Ifi44 G A 3: 151,749,309 P93L probably benign Het
Izumo2 T A 7: 44,713,046 M78K probably benign Het
Lin54 T C 5: 100,446,671 E545G probably damaging Het
Map3k13 A T 16: 21,908,704 I439F possibly damaging Het
Matr3 T G 18: 35,572,587 S188R probably damaging Het
Mug1 A T 6: 121,881,683 H1120L Het
Ndst4 A G 3: 125,681,153 probably benign Het
Nlrp3 G A 11: 59,565,044 V889M probably benign Het
Olfr1030 A T 2: 85,984,199 M120L probably benign Het
Olfr1375 A G 11: 51,048,628 I174V probably benign Het
Olfr456 A G 6: 42,486,278 M305T probably benign Het
Olfr985 T A 9: 40,127,184 Y259F probably damaging Het
Olfr998 A G 2: 85,591,184 I215V probably benign Het
P4hb A T 11: 120,568,002 D182E probably benign Het
Pcdh10 A G 3: 45,384,185 T926A possibly damaging Het
Pikfyve T C 1: 65,246,970 S1078P probably benign Het
Plcl2 A T 17: 50,608,762 D933V probably damaging Het
Pramel7 G A 2: 87,491,268 T141I probably benign Het
Prepl A T 17: 85,068,926 C567S probably damaging Het
Prpsap1 A T 11: 116,479,789 M114K probably damaging Het
Ptk2b A C 14: 66,170,236 probably null Het
Rest T C 5: 77,282,868 F1045L possibly damaging Het
Rnf19a A G 15: 36,260,138 C254R probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,579,906 probably benign Het
Setdb1 T A 3: 95,356,172 M8L probably benign Het
Setdb2 A G 14: 59,409,507 S536P probably damaging Het
Sipa1l1 T C 12: 82,357,266 L511P probably damaging Het
Slc12a9 T A 5: 137,328,493 H234L probably benign Het
Slc35e2 G T 4: 155,610,085 G30W probably damaging Het
Slc6a15 T C 10: 103,393,496 V132A probably damaging Het
Slc7a10 A G 7: 35,200,450 T486A probably benign Het
Smc5 T C 19: 23,259,762 Y235C probably benign Het
Sorcs3 T C 19: 48,796,469 probably null Het
Spata21 T C 4: 141,104,905 L459P probably damaging Het
Tbc1d9 A G 8: 83,254,823 I706M probably damaging Het
Tcp11 T A 17: 28,080,230 E17V probably damaging Het
Tiparp A G 3: 65,531,878 D23G probably benign Het
Tmem108 A G 9: 103,499,957 S98P possibly damaging Het
Tmem35b A G 4: 127,127,880 D56G probably damaging Het
Tnr G C 1: 159,858,297 G366A probably damaging Het
Ttc3 A G 16: 94,429,499 S852G possibly damaging Het
Ttn G A 2: 76,766,594 L19992F probably damaging Het
Ush2a T A 1: 188,400,308 M909K probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wif1 A G 10: 121,099,779 H333R probably benign Het
Zfp119a A G 17: 55,865,551 C431R probably damaging Het
Zfp345 G A 2: 150,472,357 P420L probably benign Het
Zfp608 C T 18: 54,900,229 D411N possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp74 A G 7: 29,935,347 V312A possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9622:Atp13a4 UTSW 16 29420459 missense
R9727:Atp13a4 UTSW 16 29409771 missense not run
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTCAAAATCCCAGGGTCAG -3'
(R):5'- ACACAGAGCTGTTCACTGC -3'

Sequencing Primer
(F):5'- CCCAGGGTCAGAAAATTCATTTTAC -3'
(R):5'- TCTCTTCCAGGAACCTCCGGAG -3'
Posted On 2021-08-31