Incidental Mutation 'R8940:Atp13a4'
ID 680943
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 4631413J11Rik, 9330174J19Rik
MMRRC Submission 068780-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 29214671-29363682 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29273508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039090
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000057018
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably benign
Transcript: ENSMUST00000182627
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,241,068 (GRCm39) S1709T probably benign Het
Abcc12 A G 8: 87,287,440 (GRCm39) V135A probably benign Het
Alkbh3 G T 2: 93,838,391 (GRCm39) P60H probably damaging Het
Armc3 A C 2: 19,240,393 (GRCm39) Y50S probably damaging Het
Arpc4 T C 6: 113,362,599 (GRCm39) V70A probably benign Het
Bco1 A T 8: 117,857,347 (GRCm39) Y438F probably benign Het
Cacna1b C A 2: 24,653,084 (GRCm39) probably benign Het
Cdh17 C T 4: 11,783,226 (GRCm39) S189L probably damaging Het
Cltc T C 11: 86,621,072 (GRCm39) T312A probably benign Het
Crym T A 7: 119,794,703 (GRCm39) N172I probably benign Het
Depdc7 A G 2: 104,554,913 (GRCm39) probably null Het
Dnhd1 T A 7: 105,363,854 (GRCm39) probably benign Het
Dntt T A 19: 41,046,990 (GRCm39) probably benign Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Fat2 A T 11: 55,147,636 (GRCm39) L3869M possibly damaging Het
Garnl3 T C 2: 32,895,241 (GRCm39) probably null Het
Gldc C T 19: 30,128,884 (GRCm39) M196I probably benign Het
Gm17078 C T 14: 51,846,342 (GRCm39) V120M probably damaging Het
Gm5157 G A 7: 20,918,685 (GRCm39) S286F probably damaging Het
Gm6337 C T 14: 6,055,308 (GRCm38) C187Y probably damaging Het
Golgb1 A G 16: 36,736,759 (GRCm39) D2002G probably damaging Het
Gpr179 T C 11: 97,228,675 (GRCm39) N1160S probably damaging Het
Gulo A G 14: 66,235,040 (GRCm39) V227A probably benign Het
Hlcs G A 16: 94,032,085 (GRCm39) A31V probably benign Het
Hs1bp3 T C 12: 8,391,980 (GRCm39) S361P probably benign Het
Ifi44 G A 3: 151,454,946 (GRCm39) P93L probably benign Het
Izumo2 T A 7: 44,362,470 (GRCm39) M78K probably benign Het
Lin54 T C 5: 100,594,530 (GRCm39) E545G probably damaging Het
Map3k13 A T 16: 21,727,454 (GRCm39) I439F possibly damaging Het
Matr3 T G 18: 35,705,640 (GRCm39) S188R probably damaging Het
Mug1 A T 6: 121,858,642 (GRCm39) H1120L Het
Myef2l A T 3: 10,153,406 (GRCm39) L58F probably benign Het
Ndst4 A G 3: 125,474,802 (GRCm39) probably benign Het
Nlrp3 G A 11: 59,455,870 (GRCm39) V889M probably benign Het
Or1x6 A G 11: 50,939,455 (GRCm39) I174V probably benign Het
Or2r2 A G 6: 42,463,212 (GRCm39) M305T probably benign Het
Or5g29 A G 2: 85,421,528 (GRCm39) I215V probably benign Het
Or5m5 A T 2: 85,814,543 (GRCm39) M120L probably benign Het
Or8d4 T A 9: 40,038,480 (GRCm39) Y259F probably damaging Het
P4hb A T 11: 120,458,828 (GRCm39) D182E probably benign Het
Pcdh10 A G 3: 45,338,620 (GRCm39) T926A possibly damaging Het
Pikfyve T C 1: 65,286,129 (GRCm39) S1078P probably benign Het
Plcl2 A T 17: 50,915,790 (GRCm39) D933V probably damaging Het
Pramel7 G A 2: 87,321,612 (GRCm39) T141I probably benign Het
Prepl A T 17: 85,376,354 (GRCm39) C567S probably damaging Het
Prpsap1 A T 11: 116,370,615 (GRCm39) M114K probably damaging Het
Ptk2b A C 14: 66,407,685 (GRCm39) probably null Het
Rest T C 5: 77,430,715 (GRCm39) F1045L possibly damaging Het
Rnf19a A G 15: 36,260,284 (GRCm39) C254R probably damaging Het
Rrad C T 8: 105,355,222 (GRCm39) R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Setdb1 T A 3: 95,263,483 (GRCm39) M8L probably benign Het
Setdb2 A G 14: 59,646,956 (GRCm39) S536P probably damaging Het
Sipa1l1 T C 12: 82,404,040 (GRCm39) L511P probably damaging Het
Slc12a9 T A 5: 137,326,755 (GRCm39) H234L probably benign Het
Slc35e2 G T 4: 155,694,542 (GRCm39) G30W probably damaging Het
Slc6a15 T C 10: 103,229,357 (GRCm39) V132A probably damaging Het
Slc7a10 A G 7: 34,899,875 (GRCm39) T486A probably benign Het
Smc5 T C 19: 23,237,126 (GRCm39) Y235C probably benign Het
Sorcs3 T C 19: 48,784,908 (GRCm39) probably null Het
Spata21 T C 4: 140,832,216 (GRCm39) L459P probably damaging Het
Tbc1d9 A G 8: 83,981,452 (GRCm39) I706M probably damaging Het
Tcp11 T A 17: 28,299,204 (GRCm39) E17V probably damaging Het
Tiparp A G 3: 65,439,299 (GRCm39) D23G probably benign Het
Tmem108 A G 9: 103,377,156 (GRCm39) S98P possibly damaging Het
Tmem35b A G 4: 127,021,673 (GRCm39) D56G probably damaging Het
Tnr G C 1: 159,685,867 (GRCm39) G366A probably damaging Het
Ttc3 A G 16: 94,230,358 (GRCm39) S852G possibly damaging Het
Ttn G A 2: 76,596,938 (GRCm39) L19992F probably damaging Het
Ush2a T A 1: 188,132,505 (GRCm39) M909K probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wif1 A G 10: 120,935,684 (GRCm39) H333R probably benign Het
Zfp119a A G 17: 56,172,551 (GRCm39) C431R probably damaging Het
Zfp345 G A 2: 150,314,277 (GRCm39) P420L probably benign Het
Zfp608 C T 18: 55,033,301 (GRCm39) D411N possibly damaging Het
Zfp609 C T 9: 65,610,561 (GRCm39) A801T possibly damaging Het
Zfp74 A G 7: 29,634,772 (GRCm39) V312A possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29,222,596 (GRCm39) splice site probably benign
IGL01577:Atp13a4 APN 16 29,260,102 (GRCm39) missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29,234,595 (GRCm39) splice site probably benign
IGL02165:Atp13a4 APN 16 29,252,828 (GRCm39) missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29,275,447 (GRCm39) missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29,258,920 (GRCm39) missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29,241,521 (GRCm39) missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29,260,125 (GRCm39) missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29,275,489 (GRCm39) missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29,274,306 (GRCm39) missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29,274,213 (GRCm39) missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29,240,542 (GRCm39) missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29,273,652 (GRCm39) missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29,290,771 (GRCm39) missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29,239,246 (GRCm39) missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29,228,528 (GRCm39) missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29,227,746 (GRCm39) missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29,275,429 (GRCm39) missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29,298,672 (GRCm39) missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29,241,502 (GRCm39) missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29,260,102 (GRCm39) missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29,237,389 (GRCm39) missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29,360,068 (GRCm39) missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29,271,421 (GRCm39) missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29,239,653 (GRCm39) intron probably benign
R4795:Atp13a4 UTSW 16 29,308,826 (GRCm39) critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29,227,779 (GRCm39) nonsense probably null
R4996:Atp13a4 UTSW 16 29,290,822 (GRCm39) missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29,228,686 (GRCm39) missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29,275,428 (GRCm39) missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29,275,422 (GRCm39) missense possibly damaging 0.94
R5395:Atp13a4 UTSW 16 29,239,706 (GRCm39) nonsense probably null
R5640:Atp13a4 UTSW 16 29,234,649 (GRCm39) missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29,275,389 (GRCm39) missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29,252,822 (GRCm39) missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29,290,719 (GRCm39) nonsense probably null
R6497:Atp13a4 UTSW 16 29,298,719 (GRCm39) missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29,298,659 (GRCm39) missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29,288,098 (GRCm39) missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29,239,723 (GRCm39) missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29,260,014 (GRCm39) missense
R7493:Atp13a4 UTSW 16 29,290,774 (GRCm39) missense
R7712:Atp13a4 UTSW 16 29,278,305 (GRCm39) missense
R7739:Atp13a4 UTSW 16 29,275,419 (GRCm39) missense
R7897:Atp13a4 UTSW 16 29,215,284 (GRCm39) missense
R7950:Atp13a4 UTSW 16 29,268,735 (GRCm39) missense
R8217:Atp13a4 UTSW 16 29,222,619 (GRCm39) missense
R8227:Atp13a4 UTSW 16 29,222,663 (GRCm39) missense
R8273:Atp13a4 UTSW 16 29,290,720 (GRCm39) missense
R8488:Atp13a4 UTSW 16 29,236,654 (GRCm39) missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29,273,587 (GRCm39) nonsense probably null
R8773:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R8921:Atp13a4 UTSW 16 29,273,592 (GRCm39) missense
R9056:Atp13a4 UTSW 16 29,290,706 (GRCm39) critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29,268,797 (GRCm39) missense
R9292:Atp13a4 UTSW 16 29,241,500 (GRCm39) missense
R9415:Atp13a4 UTSW 16 29,227,821 (GRCm39) missense
R9453:Atp13a4 UTSW 16 29,239,659 (GRCm39) missense unknown
R9497:Atp13a4 UTSW 16 29,288,130 (GRCm39) critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29,241,544 (GRCm39) missense
R9614:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R9622:Atp13a4 UTSW 16 29,239,277 (GRCm39) missense
R9727:Atp13a4 UTSW 16 29,228,589 (GRCm39) missense
Z1176:Atp13a4 UTSW 16 29,241,405 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTCAAAATCCCAGGGTCAG -3'
(R):5'- ACACAGAGCTGTTCACTGC -3'

Sequencing Primer
(F):5'- CCCAGGGTCAGAAAATTCATTTTAC -3'
(R):5'- TCTCTTCCAGGAACCTCCGGAG -3'
Posted On 2021-08-31