Incidental Mutation 'R8940:Golgb1'
ID 680944
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 068780-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36736759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2002 (D2002G)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: D2043G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: D2043G

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114812
AA Change: D2002G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: D2002G

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,241,068 (GRCm39) S1709T probably benign Het
Abcc12 A G 8: 87,287,440 (GRCm39) V135A probably benign Het
Alkbh3 G T 2: 93,838,391 (GRCm39) P60H probably damaging Het
Armc3 A C 2: 19,240,393 (GRCm39) Y50S probably damaging Het
Arpc4 T C 6: 113,362,599 (GRCm39) V70A probably benign Het
Atp13a4 A G 16: 29,273,508 (GRCm39) probably null Het
Bco1 A T 8: 117,857,347 (GRCm39) Y438F probably benign Het
Cacna1b C A 2: 24,653,084 (GRCm39) probably benign Het
Cdh17 C T 4: 11,783,226 (GRCm39) S189L probably damaging Het
Cltc T C 11: 86,621,072 (GRCm39) T312A probably benign Het
Crym T A 7: 119,794,703 (GRCm39) N172I probably benign Het
Depdc7 A G 2: 104,554,913 (GRCm39) probably null Het
Dnhd1 T A 7: 105,363,854 (GRCm39) probably benign Het
Dntt T A 19: 41,046,990 (GRCm39) probably benign Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Fat2 A T 11: 55,147,636 (GRCm39) L3869M possibly damaging Het
Garnl3 T C 2: 32,895,241 (GRCm39) probably null Het
Gldc C T 19: 30,128,884 (GRCm39) M196I probably benign Het
Gm17078 C T 14: 51,846,342 (GRCm39) V120M probably damaging Het
Gm5157 G A 7: 20,918,685 (GRCm39) S286F probably damaging Het
Gm6337 C T 14: 6,055,308 (GRCm38) C187Y probably damaging Het
Gpr179 T C 11: 97,228,675 (GRCm39) N1160S probably damaging Het
Gulo A G 14: 66,235,040 (GRCm39) V227A probably benign Het
Hlcs G A 16: 94,032,085 (GRCm39) A31V probably benign Het
Hs1bp3 T C 12: 8,391,980 (GRCm39) S361P probably benign Het
Ifi44 G A 3: 151,454,946 (GRCm39) P93L probably benign Het
Izumo2 T A 7: 44,362,470 (GRCm39) M78K probably benign Het
Lin54 T C 5: 100,594,530 (GRCm39) E545G probably damaging Het
Map3k13 A T 16: 21,727,454 (GRCm39) I439F possibly damaging Het
Matr3 T G 18: 35,705,640 (GRCm39) S188R probably damaging Het
Mug1 A T 6: 121,858,642 (GRCm39) H1120L Het
Myef2l A T 3: 10,153,406 (GRCm39) L58F probably benign Het
Ndst4 A G 3: 125,474,802 (GRCm39) probably benign Het
Nlrp3 G A 11: 59,455,870 (GRCm39) V889M probably benign Het
Or1x6 A G 11: 50,939,455 (GRCm39) I174V probably benign Het
Or2r2 A G 6: 42,463,212 (GRCm39) M305T probably benign Het
Or5g29 A G 2: 85,421,528 (GRCm39) I215V probably benign Het
Or5m5 A T 2: 85,814,543 (GRCm39) M120L probably benign Het
Or8d4 T A 9: 40,038,480 (GRCm39) Y259F probably damaging Het
P4hb A T 11: 120,458,828 (GRCm39) D182E probably benign Het
Pcdh10 A G 3: 45,338,620 (GRCm39) T926A possibly damaging Het
Pikfyve T C 1: 65,286,129 (GRCm39) S1078P probably benign Het
Plcl2 A T 17: 50,915,790 (GRCm39) D933V probably damaging Het
Pramel7 G A 2: 87,321,612 (GRCm39) T141I probably benign Het
Prepl A T 17: 85,376,354 (GRCm39) C567S probably damaging Het
Prpsap1 A T 11: 116,370,615 (GRCm39) M114K probably damaging Het
Ptk2b A C 14: 66,407,685 (GRCm39) probably null Het
Rest T C 5: 77,430,715 (GRCm39) F1045L possibly damaging Het
Rnf19a A G 15: 36,260,284 (GRCm39) C254R probably damaging Het
Rrad C T 8: 105,355,222 (GRCm39) R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Setdb1 T A 3: 95,263,483 (GRCm39) M8L probably benign Het
Setdb2 A G 14: 59,646,956 (GRCm39) S536P probably damaging Het
Sipa1l1 T C 12: 82,404,040 (GRCm39) L511P probably damaging Het
Slc12a9 T A 5: 137,326,755 (GRCm39) H234L probably benign Het
Slc35e2 G T 4: 155,694,542 (GRCm39) G30W probably damaging Het
Slc6a15 T C 10: 103,229,357 (GRCm39) V132A probably damaging Het
Slc7a10 A G 7: 34,899,875 (GRCm39) T486A probably benign Het
Smc5 T C 19: 23,237,126 (GRCm39) Y235C probably benign Het
Sorcs3 T C 19: 48,784,908 (GRCm39) probably null Het
Spata21 T C 4: 140,832,216 (GRCm39) L459P probably damaging Het
Tbc1d9 A G 8: 83,981,452 (GRCm39) I706M probably damaging Het
Tcp11 T A 17: 28,299,204 (GRCm39) E17V probably damaging Het
Tiparp A G 3: 65,439,299 (GRCm39) D23G probably benign Het
Tmem108 A G 9: 103,377,156 (GRCm39) S98P possibly damaging Het
Tmem35b A G 4: 127,021,673 (GRCm39) D56G probably damaging Het
Tnr G C 1: 159,685,867 (GRCm39) G366A probably damaging Het
Ttc3 A G 16: 94,230,358 (GRCm39) S852G possibly damaging Het
Ttn G A 2: 76,596,938 (GRCm39) L19992F probably damaging Het
Ush2a T A 1: 188,132,505 (GRCm39) M909K probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wif1 A G 10: 120,935,684 (GRCm39) H333R probably benign Het
Zfp119a A G 17: 56,172,551 (GRCm39) C431R probably damaging Het
Zfp345 G A 2: 150,314,277 (GRCm39) P420L probably benign Het
Zfp608 C T 18: 55,033,301 (GRCm39) D411N possibly damaging Het
Zfp609 C T 9: 65,610,561 (GRCm39) A801T possibly damaging Het
Zfp74 A G 7: 29,634,772 (GRCm39) V312A possibly damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAAGGTGCCCAGAAAGG -3'
(R):5'- TTGCTCCAGTCTTCGCAAG -3'

Sequencing Primer
(F):5'- GGGCCGGCCAATAAAAGCC -3'
(R):5'- CGCAAGAGGTCTTCATCTTTTTG -3'
Posted On 2021-08-31