Incidental Mutation 'R8940:Zfp119a'
ID 680950
Institutional Source Beutler Lab
Gene Symbol Zfp119a
Ensembl Gene ENSMUSG00000057835
Gene Name zinc finger protein 119a
Synonyms Mzf13, Zfp119
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 55864892-55878930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55865551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 431 (C431R)
Ref Sequence ENSEMBL: ENSMUSP00000078587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079642]
AlphaFold Q9JIC0
Predicted Effect probably damaging
Transcript: ENSMUST00000079642
AA Change: C431R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078587
Gene: ENSMUSG00000057835
AA Change: C431R

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
ZnF_C2H2 155 177 1.57e2 SMART
ZnF_C2H2 261 283 2.14e2 SMART
ZnF_C2H2 289 311 6.78e-3 SMART
ZnF_C2H2 317 339 1.98e-4 SMART
ZnF_C2H2 345 367 4.17e-3 SMART
ZnF_C2H2 373 395 3.39e-3 SMART
ZnF_C2H2 401 423 1.64e-1 SMART
ZnF_C2H2 429 451 5.5e-3 SMART
ZnF_C2H2 457 479 1.51e0 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
ZnF_C2H2 513 535 1.69e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,093,202 S1709T probably benign Het
Abcc12 A G 8: 86,560,811 V135A probably benign Het
Alkbh3 G T 2: 94,008,046 P60H probably damaging Het
Armc3 A C 2: 19,235,582 Y50S probably damaging Het
Arpc4 T C 6: 113,385,638 V70A probably benign Het
Atp13a4 A G 16: 29,454,690 probably null Het
Bco1 A T 8: 117,130,608 Y438F probably benign Het
Cacna1b C A 2: 24,763,072 probably benign Het
Cdh17 C T 4: 11,783,226 S189L probably damaging Het
Cltc T C 11: 86,730,246 T312A probably benign Het
Crym T A 7: 120,195,480 N172I probably benign Het
Depdc7 A G 2: 104,724,568 probably null Het
Dnhd1 T A 7: 105,714,647 probably benign Het
Dntt T A 19: 41,058,551 probably benign Het
Elovl5 T A 9: 77,982,725 S273T possibly damaging Het
Fat2 A T 11: 55,256,810 L3869M possibly damaging Het
Garnl3 T C 2: 33,005,229 probably null Het
Gldc C T 19: 30,151,484 M196I probably benign Het
Gm17078 C T 14: 51,608,885 V120M probably damaging Het
Gm5157 G A 7: 21,184,760 S286F probably damaging Het
Gm6337 C T 14: 6,055,308 C187Y probably damaging Het
Gm9833 A T 3: 10,088,346 L58F probably benign Het
Golgb1 A G 16: 36,916,397 D2002G probably damaging Het
Gpr179 T C 11: 97,337,849 N1160S probably damaging Het
Gulo A G 14: 65,997,591 V227A probably benign Het
Hlcs G A 16: 94,231,226 A31V probably benign Het
Hs1bp3 T C 12: 8,341,980 S361P probably benign Het
Ifi44 G A 3: 151,749,309 P93L probably benign Het
Izumo2 T A 7: 44,713,046 M78K probably benign Het
Lin54 T C 5: 100,446,671 E545G probably damaging Het
Map3k13 A T 16: 21,908,704 I439F possibly damaging Het
Matr3 T G 18: 35,572,587 S188R probably damaging Het
Mug1 A T 6: 121,881,683 H1120L Het
Ndst4 A G 3: 125,681,153 probably benign Het
Nlrp3 G A 11: 59,565,044 V889M probably benign Het
Olfr1030 A T 2: 85,984,199 M120L probably benign Het
Olfr1375 A G 11: 51,048,628 I174V probably benign Het
Olfr456 A G 6: 42,486,278 M305T probably benign Het
Olfr985 T A 9: 40,127,184 Y259F probably damaging Het
Olfr998 A G 2: 85,591,184 I215V probably benign Het
P4hb A T 11: 120,568,002 D182E probably benign Het
Pcdh10 A G 3: 45,384,185 T926A possibly damaging Het
Pikfyve T C 1: 65,246,970 S1078P probably benign Het
Plcl2 A T 17: 50,608,762 D933V probably damaging Het
Pramel7 G A 2: 87,491,268 T141I probably benign Het
Prepl A T 17: 85,068,926 C567S probably damaging Het
Prpsap1 A T 11: 116,479,789 M114K probably damaging Het
Ptk2b A C 14: 66,170,236 probably null Het
Rest T C 5: 77,282,868 F1045L possibly damaging Het
Rnf19a A G 15: 36,260,138 C254R probably damaging Het
Rrad C T 8: 104,628,590 R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,579,906 probably benign Het
Setdb1 T A 3: 95,356,172 M8L probably benign Het
Setdb2 A G 14: 59,409,507 S536P probably damaging Het
Sipa1l1 T C 12: 82,357,266 L511P probably damaging Het
Slc12a9 T A 5: 137,328,493 H234L probably benign Het
Slc35e2 G T 4: 155,610,085 G30W probably damaging Het
Slc6a15 T C 10: 103,393,496 V132A probably damaging Het
Slc7a10 A G 7: 35,200,450 T486A probably benign Het
Smc5 T C 19: 23,259,762 Y235C probably benign Het
Sorcs3 T C 19: 48,796,469 probably null Het
Spata21 T C 4: 141,104,905 L459P probably damaging Het
Tbc1d9 A G 8: 83,254,823 I706M probably damaging Het
Tcp11 T A 17: 28,080,230 E17V probably damaging Het
Tiparp A G 3: 65,531,878 D23G probably benign Het
Tmem108 A G 9: 103,499,957 S98P possibly damaging Het
Tmem35b A G 4: 127,127,880 D56G probably damaging Het
Tnr G C 1: 159,858,297 G366A probably damaging Het
Ttc3 A G 16: 94,429,499 S852G possibly damaging Het
Ttn G A 2: 76,766,594 L19992F probably damaging Het
Ush2a T A 1: 188,400,308 M909K probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wif1 A G 10: 121,099,779 H333R probably benign Het
Zfp345 G A 2: 150,472,357 P420L probably benign Het
Zfp608 C T 18: 54,900,229 D411N possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp74 A G 7: 29,935,347 V312A possibly damaging Het
Other mutations in Zfp119a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp119a APN 17 55865792 nonsense probably null
R0421:Zfp119a UTSW 17 55865248 nonsense probably null
R1385:Zfp119a UTSW 17 55865826 missense probably damaging 1.00
R1600:Zfp119a UTSW 17 55868355 missense possibly damaging 0.93
R2310:Zfp119a UTSW 17 55865440 missense probably benign 0.00
R2924:Zfp119a UTSW 17 55868343 missense possibly damaging 0.96
R3910:Zfp119a UTSW 17 55866520 missense probably benign
R4594:Zfp119a UTSW 17 55866325 missense probably benign
R5217:Zfp119a UTSW 17 55865425 nonsense probably null
R5321:Zfp119a UTSW 17 55865595 missense probably damaging 1.00
R5392:Zfp119a UTSW 17 55866328 missense probably benign 0.03
R5678:Zfp119a UTSW 17 55868336 missense probably benign 0.03
R7033:Zfp119a UTSW 17 55866009 missense probably benign 0.04
R7355:Zfp119a UTSW 17 55866287 nonsense probably null
R7489:Zfp119a UTSW 17 55866158 missense probably damaging 1.00
R8130:Zfp119a UTSW 17 55865971 missense probably damaging 1.00
Z1176:Zfp119a UTSW 17 55866011 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGAAATGAGTGTGTTACCCAAGAC -3'
(R):5'- GCATATCGCAATAGTCTTCACATTC -3'

Sequencing Primer
(F):5'- TGCTCTTGAAGAGTACTGAGACATGC -3'
(R):5'- CGCAATAGTCTTCACATTCATGAAAG -3'
Posted On 2021-08-31