Incidental Mutation 'R8940:Gldc'
ID 680955
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8940 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30128884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 196 (M196I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: M196I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: M196I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,241,068 (GRCm39) S1709T probably benign Het
Abcc12 A G 8: 87,287,440 (GRCm39) V135A probably benign Het
Alkbh3 G T 2: 93,838,391 (GRCm39) P60H probably damaging Het
Armc3 A C 2: 19,240,393 (GRCm39) Y50S probably damaging Het
Arpc4 T C 6: 113,362,599 (GRCm39) V70A probably benign Het
Atp13a4 A G 16: 29,273,508 (GRCm39) probably null Het
Bco1 A T 8: 117,857,347 (GRCm39) Y438F probably benign Het
Cacna1b C A 2: 24,653,084 (GRCm39) probably benign Het
Cdh17 C T 4: 11,783,226 (GRCm39) S189L probably damaging Het
Cltc T C 11: 86,621,072 (GRCm39) T312A probably benign Het
Crym T A 7: 119,794,703 (GRCm39) N172I probably benign Het
Depdc7 A G 2: 104,554,913 (GRCm39) probably null Het
Dnhd1 T A 7: 105,363,854 (GRCm39) probably benign Het
Dntt T A 19: 41,046,990 (GRCm39) probably benign Het
Elovl5 T A 9: 77,890,007 (GRCm39) S273T possibly damaging Het
Fat2 A T 11: 55,147,636 (GRCm39) L3869M possibly damaging Het
Garnl3 T C 2: 32,895,241 (GRCm39) probably null Het
Gm17078 C T 14: 51,846,342 (GRCm39) V120M probably damaging Het
Gm5157 G A 7: 20,918,685 (GRCm39) S286F probably damaging Het
Gm6337 C T 14: 6,055,308 (GRCm38) C187Y probably damaging Het
Golgb1 A G 16: 36,736,759 (GRCm39) D2002G probably damaging Het
Gpr179 T C 11: 97,228,675 (GRCm39) N1160S probably damaging Het
Gulo A G 14: 66,235,040 (GRCm39) V227A probably benign Het
Hlcs G A 16: 94,032,085 (GRCm39) A31V probably benign Het
Hs1bp3 T C 12: 8,391,980 (GRCm39) S361P probably benign Het
Ifi44 G A 3: 151,454,946 (GRCm39) P93L probably benign Het
Izumo2 T A 7: 44,362,470 (GRCm39) M78K probably benign Het
Lin54 T C 5: 100,594,530 (GRCm39) E545G probably damaging Het
Map3k13 A T 16: 21,727,454 (GRCm39) I439F possibly damaging Het
Matr3 T G 18: 35,705,640 (GRCm39) S188R probably damaging Het
Mug1 A T 6: 121,858,642 (GRCm39) H1120L Het
Myef2l A T 3: 10,153,406 (GRCm39) L58F probably benign Het
Ndst4 A G 3: 125,474,802 (GRCm39) probably benign Het
Nlrp3 G A 11: 59,455,870 (GRCm39) V889M probably benign Het
Or1x6 A G 11: 50,939,455 (GRCm39) I174V probably benign Het
Or2r2 A G 6: 42,463,212 (GRCm39) M305T probably benign Het
Or5g29 A G 2: 85,421,528 (GRCm39) I215V probably benign Het
Or5m5 A T 2: 85,814,543 (GRCm39) M120L probably benign Het
Or8d4 T A 9: 40,038,480 (GRCm39) Y259F probably damaging Het
P4hb A T 11: 120,458,828 (GRCm39) D182E probably benign Het
Pcdh10 A G 3: 45,338,620 (GRCm39) T926A possibly damaging Het
Pikfyve T C 1: 65,286,129 (GRCm39) S1078P probably benign Het
Plcl2 A T 17: 50,915,790 (GRCm39) D933V probably damaging Het
Pramel7 G A 2: 87,321,612 (GRCm39) T141I probably benign Het
Prepl A T 17: 85,376,354 (GRCm39) C567S probably damaging Het
Prpsap1 A T 11: 116,370,615 (GRCm39) M114K probably damaging Het
Ptk2b A C 14: 66,407,685 (GRCm39) probably null Het
Rest T C 5: 77,430,715 (GRCm39) F1045L possibly damaging Het
Rnf19a A G 15: 36,260,284 (GRCm39) C254R probably damaging Het
Rrad C T 8: 105,355,222 (GRCm39) R262Q possibly damaging Het
Rsf1 GGCG GGCGACTGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Setdb1 T A 3: 95,263,483 (GRCm39) M8L probably benign Het
Setdb2 A G 14: 59,646,956 (GRCm39) S536P probably damaging Het
Sipa1l1 T C 12: 82,404,040 (GRCm39) L511P probably damaging Het
Slc12a9 T A 5: 137,326,755 (GRCm39) H234L probably benign Het
Slc35e2 G T 4: 155,694,542 (GRCm39) G30W probably damaging Het
Slc6a15 T C 10: 103,229,357 (GRCm39) V132A probably damaging Het
Slc7a10 A G 7: 34,899,875 (GRCm39) T486A probably benign Het
Smc5 T C 19: 23,237,126 (GRCm39) Y235C probably benign Het
Sorcs3 T C 19: 48,784,908 (GRCm39) probably null Het
Spata21 T C 4: 140,832,216 (GRCm39) L459P probably damaging Het
Tbc1d9 A G 8: 83,981,452 (GRCm39) I706M probably damaging Het
Tcp11 T A 17: 28,299,204 (GRCm39) E17V probably damaging Het
Tiparp A G 3: 65,439,299 (GRCm39) D23G probably benign Het
Tmem108 A G 9: 103,377,156 (GRCm39) S98P possibly damaging Het
Tmem35b A G 4: 127,021,673 (GRCm39) D56G probably damaging Het
Tnr G C 1: 159,685,867 (GRCm39) G366A probably damaging Het
Ttc3 A G 16: 94,230,358 (GRCm39) S852G possibly damaging Het
Ttn G A 2: 76,596,938 (GRCm39) L19992F probably damaging Het
Ush2a T A 1: 188,132,505 (GRCm39) M909K probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wif1 A G 10: 120,935,684 (GRCm39) H333R probably benign Het
Zfp119a A G 17: 56,172,551 (GRCm39) C431R probably damaging Het
Zfp345 G A 2: 150,314,277 (GRCm39) P420L probably benign Het
Zfp608 C T 18: 55,033,301 (GRCm39) D411N possibly damaging Het
Zfp609 C T 9: 65,610,561 (GRCm39) A801T possibly damaging Het
Zfp74 A G 7: 29,634,772 (GRCm39) V312A possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAATATGGCAGAAAGACTC -3'
(R):5'- ACAAAGGGATTTCAGGAGCTTTTC -3'

Sequencing Primer
(F):5'- CATGAACTGTTTCAGGCAGC -3'
(R):5'- AGCTTTTCTGGTCAGGAGC -3'
Posted On 2021-08-31