Incidental Mutation 'R8941:Gm6309'
ID 680982
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Name predicted gene 6309
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8941 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 146167976-146170721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 146170345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 64 (Y64H)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
AlphaFold L7N481
Predicted Effect probably damaging
Transcript: ENSMUST00000174320
AA Change: Y64H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: Y64H

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,049 T103S probably benign Het
Aass A T 6: 23,075,262 probably benign Het
Adgrb3 A T 1: 25,094,154 C1284S probably damaging Het
Adora2a G A 10: 75,333,725 W341* probably null Het
Arap1 G A 7: 101,408,117 R1355Q possibly damaging Het
Asic5 A T 3: 82,006,608 probably benign Het
BC027072 T C 17: 71,752,142 H180R probably benign Het
BC051142 A C 17: 34,459,999 R228S possibly damaging Het
Canx T C 11: 50,304,443 D266G possibly damaging Het
Cfap57 A T 4: 118,569,602 Y1080N probably damaging Het
Chat C T 14: 32,409,006 M559I probably benign Het
Chd5 G A 4: 152,378,848 S1425N possibly damaging Het
Cog8 T C 8: 107,056,570 D29G probably damaging Het
Cox15 A G 19: 43,743,733 S215P probably benign Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Dbt T C 3: 116,546,049 V362A probably damaging Het
Dio1 C A 4: 107,306,950 A57S probably benign Het
F5 C A 1: 164,198,871 H1671N probably benign Het
Gm15448 A G 7: 3,822,381 S421P probably damaging Het
Gm8298 A G 3: 59,876,979 Y291C probably damaging Het
Hipk1 A G 3: 103,753,427 C731R probably damaging Het
Hmgcl G A 4: 135,955,704 A156T probably damaging Het
Il15ra A T 2: 11,733,184 T210S possibly damaging Het
Kat8 T C 7: 127,925,228 L426P probably damaging Het
Lrrc39 G T 3: 116,565,847 V14L probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mdm4 T C 1: 132,991,933 H398R probably benign Het
Mroh2b A T 15: 4,962,124 Q1568L possibly damaging Het
Myo18b G A 5: 112,874,929 probably benign Het
Nr4a3 C A 4: 48,051,756 P170Q possibly damaging Het
Ntrk2 A G 13: 59,060,295 M652V probably damaging Het
Olfr1443 G A 19: 12,680,107 probably benign Het
Olfr964-ps1 A T 9: 39,686,516 *143K probably null Het
Paxbp1 T C 16: 91,035,927 I325V possibly damaging Het
Pi4ka G T 16: 17,296,943 probably benign Het
Pou6f1 T A 15: 100,591,861 D74V probably damaging Het
Prpsap2 C A 11: 61,737,044 R202L probably damaging Het
Ptprn A T 1: 75,251,763 L890Q probably damaging Het
Ramp1 C G 1: 91,206,415 P97A probably benign Het
Rapgefl1 A G 11: 98,840,275 D179G probably damaging Het
Rbp3 T A 14: 33,956,529 F811L possibly damaging Het
Rnf213 C A 11: 119,414,424 L494M probably damaging Het
Rpl4 A G 9: 64,174,963 N48S probably benign Het
Rsbn1l A G 5: 20,905,843 V499A probably damaging Het
Sacs A G 14: 61,192,573 T691A probably benign Het
Sass6 T C 3: 116,614,060 V275A probably benign Het
Sdcbp T C 4: 6,393,661 S259P probably benign Het
Sephs2 A G 7: 127,273,034 F296L probably benign Het
Slc12a4 C T 8: 105,946,690 probably null Het
Snrk G A 9: 122,160,531 V314I probably benign Het
Spata5 T A 3: 37,431,993 L288H probably damaging Het
Tas1r3 C T 4: 155,863,143 probably null Het
Tle3 T A 9: 61,412,913 V560E probably damaging Het
Trdmt1 A G 2: 13,522,107 Y144H probably benign Het
Trim42 T C 9: 97,363,047 T567A probably benign Het
Tuba4a T C 1: 75,217,301 D74G probably benign Het
Ube3c G A 5: 29,637,771 probably null Het
Vwa3a A G 7: 120,776,088 D375G probably benign Het
Zfp729b A G 13: 67,593,099 M349T possibly damaging Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5776:Gm6309 UTSW 5 146168881 missense possibly damaging 0.80
R5833:Gm6309 UTSW 5 146168318 missense probably damaging 1.00
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6373:Gm6309 UTSW 5 146170275 missense probably damaging 0.97
R6873:Gm6309 UTSW 5 146168188 missense probably damaging 0.96
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
R7145:Gm6309 UTSW 5 146170290 missense possibly damaging 0.74
R7258:Gm6309 UTSW 5 146168296 missense probably benign 0.07
R7535:Gm6309 UTSW 5 146168290 missense probably damaging 1.00
R8885:Gm6309 UTSW 5 146168293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTATGTTGGATGCAGCC -3'
(R):5'- TGAGCCCAAGGTAACAACAG -3'

Sequencing Primer
(F):5'- ATGTTGGATGCAGCCACTCAC -3'
(R):5'- GCCAGCCTTAGCAAGAAAGTTTTTG -3'
Posted On 2021-08-31