Incidental Mutation 'R8941:Cox15'
ID 681015
Institutional Source Beutler Lab
Gene Symbol Cox15
Ensembl Gene ENSMUSG00000040018
Gene Name cytochrome c oxidase assembly protein 15
Synonyms 2900026G05Rik
MMRRC Submission 068781-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8941 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43721693-43741439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43732172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000041820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045562]
AlphaFold Q8BJ03
Predicted Effect probably benign
Transcript: ENSMUST00000045562
AA Change: S215P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041820
Gene: ENSMUSG00000040018
AA Change: S215P

DomainStartEndE-ValueType
Pfam:COX15-CtaA 73 402 2.3e-112 PFAM
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,679 (GRCm39) T103S probably benign Het
Aadacl2fm3 A G 3: 59,784,400 (GRCm39) Y291C probably damaging Het
Aass A T 6: 23,075,261 (GRCm39) probably benign Het
Adgrb3 A T 1: 25,133,235 (GRCm39) C1284S probably damaging Het
Adora2a G A 10: 75,169,559 (GRCm39) W341* probably null Het
Afg2a T A 3: 37,486,142 (GRCm39) L288H probably damaging Het
Arap1 G A 7: 101,057,324 (GRCm39) R1355Q possibly damaging Het
Asic5 A T 3: 81,913,915 (GRCm39) probably benign Het
Canx T C 11: 50,195,270 (GRCm39) D266G possibly damaging Het
Cfap57 A T 4: 118,426,799 (GRCm39) Y1080N probably damaging Het
Chat C T 14: 32,130,963 (GRCm39) M559I probably benign Het
Chd5 G A 4: 152,463,305 (GRCm39) S1425N possibly damaging Het
Cog8 T C 8: 107,783,202 (GRCm39) D29G probably damaging Het
Cramp1 C T 17: 25,202,114 (GRCm39) G456D probably damaging Het
Dbt T C 3: 116,339,698 (GRCm39) V362A probably damaging Het
Dio1 C A 4: 107,164,147 (GRCm39) A57S probably benign Het
F5 C A 1: 164,026,440 (GRCm39) H1671N probably benign Het
Gm6309 A G 5: 146,107,155 (GRCm39) Y64H probably damaging Het
Hipk1 A G 3: 103,660,743 (GRCm39) C731R probably damaging Het
Hmgcl G A 4: 135,683,015 (GRCm39) A156T probably damaging Het
Il15ra A T 2: 11,737,995 (GRCm39) T210S possibly damaging Het
Kat8 T C 7: 127,524,400 (GRCm39) L426P probably damaging Het
Lrrc39 G T 3: 116,359,496 (GRCm39) V14L probably damaging Het
Lrrc7 T C 3: 157,869,593 (GRCm39) M709V probably benign Het
Mdm4 T C 1: 132,919,671 (GRCm39) H398R probably benign Het
Mroh2b A T 15: 4,991,606 (GRCm39) Q1568L possibly damaging Het
Myo18b G A 5: 113,022,795 (GRCm39) probably benign Het
Nr4a3 C A 4: 48,051,756 (GRCm39) P170Q possibly damaging Het
Ntrk2 A G 13: 59,208,109 (GRCm39) M652V probably damaging Het
Or10n7-ps1 A T 9: 39,597,812 (GRCm39) *143K probably null Het
Or5b95 G A 19: 12,657,471 (GRCm39) probably benign Het
Paxbp1 T C 16: 90,832,815 (GRCm39) I325V possibly damaging Het
Pcare T C 17: 72,059,137 (GRCm39) H180R probably benign Het
Pi4ka G T 16: 17,114,807 (GRCm39) probably benign Het
Pira13 A G 7: 3,825,380 (GRCm39) S421P probably damaging Het
Pou6f1 T A 15: 100,489,742 (GRCm39) D74V probably damaging Het
Prpsap2 C A 11: 61,627,870 (GRCm39) R202L probably damaging Het
Ptprn A T 1: 75,228,407 (GRCm39) L890Q probably damaging Het
Ramp1 C G 1: 91,134,137 (GRCm39) P97A probably benign Het
Rapgefl1 A G 11: 98,731,101 (GRCm39) D179G probably damaging Het
Rbp3 T A 14: 33,678,486 (GRCm39) F811L possibly damaging Het
Rnf213 C A 11: 119,305,250 (GRCm39) L494M probably damaging Het
Rpl4 A G 9: 64,082,245 (GRCm39) N48S probably benign Het
Rsbn1l A G 5: 21,110,841 (GRCm39) V499A probably damaging Het
Sacs A G 14: 61,430,022 (GRCm39) T691A probably benign Het
Sass6 T C 3: 116,407,709 (GRCm39) V275A probably benign Het
Sdcbp T C 4: 6,393,661 (GRCm39) S259P probably benign Het
Sephs2 A G 7: 126,872,206 (GRCm39) F296L probably benign Het
Slc12a4 C T 8: 106,673,322 (GRCm39) probably null Het
Snrk G A 9: 121,989,597 (GRCm39) V314I probably benign Het
Tas1r3 C T 4: 155,947,600 (GRCm39) probably null Het
Tle3 T A 9: 61,320,195 (GRCm39) V560E probably damaging Het
Trdmt1 A G 2: 13,526,918 (GRCm39) Y144H probably benign Het
Trim42 T C 9: 97,245,100 (GRCm39) T567A probably benign Het
Tsbp1 A C 17: 34,678,973 (GRCm39) R228S possibly damaging Het
Tuba4a T C 1: 75,193,945 (GRCm39) D74G probably benign Het
Ube3c G A 5: 29,842,769 (GRCm39) probably null Het
Vwa3a A G 7: 120,375,311 (GRCm39) D375G probably benign Het
Zfp729b A G 13: 67,741,218 (GRCm39) M349T possibly damaging Het
Other mutations in Cox15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cox15 APN 19 43,732,104 (GRCm39) nonsense probably null
R0122:Cox15 UTSW 19 43,737,229 (GRCm39) missense possibly damaging 0.56
R1452:Cox15 UTSW 19 43,735,344 (GRCm39) missense probably damaging 1.00
R1931:Cox15 UTSW 19 43,735,224 (GRCm39) missense probably benign 0.01
R1932:Cox15 UTSW 19 43,735,224 (GRCm39) missense probably benign 0.01
R6268:Cox15 UTSW 19 43,728,365 (GRCm39) missense possibly damaging 0.88
R6720:Cox15 UTSW 19 43,725,228 (GRCm39) missense probably damaging 1.00
R7141:Cox15 UTSW 19 43,725,186 (GRCm39) missense probably benign 0.05
R7743:Cox15 UTSW 19 43,728,380 (GRCm39) missense possibly damaging 0.94
R8545:Cox15 UTSW 19 43,728,421 (GRCm39) missense probably damaging 1.00
R8698:Cox15 UTSW 19 43,739,948 (GRCm39) missense probably benign
R8725:Cox15 UTSW 19 43,735,181 (GRCm39) nonsense probably null
R8727:Cox15 UTSW 19 43,735,181 (GRCm39) nonsense probably null
R9650:Cox15 UTSW 19 43,735,318 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGAACCAGCTTTTCCACTGC -3'
(R):5'- TAAGTCTAAAGAGTAGCCAAGCAC -3'

Sequencing Primer
(F):5'- ACTGCCCTGCCATGTCAG -3'
(R):5'- TACAGCGATCCTGAACACTGG -3'
Posted On 2021-08-31