Incidental Mutation 'R8942:Atp8b5'
ID681029
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8942 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43353658 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 491 (F491L)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably damaging
Transcript: ENSMUST00000107942
AA Change: F491L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: F491L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,320 D833E probably damaging Het
Adgrl3 A T 5: 81,648,721 I626L probably benign Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Atp2b2 G T 6: 113,814,030 Q138K probably benign Het
Bcap29 T A 12: 31,634,354 M1L probably damaging Het
C1qtnf7 A G 5: 43,616,241 D294G probably benign Het
Ccdc170 C T 10: 4,534,044 A290V probably benign Het
Cfhr2 A T 1: 139,813,554 L228I probably benign Het
Clip4 T A 17: 71,863,773 V645D probably benign Het
Cyp4a31 C T 4: 115,569,721 R173W possibly damaging Het
D430042O09Rik T G 7: 125,850,803 L1013R probably damaging Het
Dis3l T C 9: 64,307,593 K898R probably benign Het
Efr3b G T 12: 3,982,091 H172Q possibly damaging Het
Eipr1 A T 12: 28,867,054 N374Y probably damaging Het
Exoc3l4 A T 12: 111,425,568 E414D possibly damaging Het
Exoc3l4 G T 12: 111,425,569 V415L probably benign Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Gapvd1 T C 2: 34,729,122 T80A probably benign Het
Gen1 A G 12: 11,242,286 S501P probably benign Het
Gm10643 A G 8: 84,064,170 probably benign Het
Gm13084 T C 4: 143,810,291 N490S probably benign Het
Hecw1 A T 13: 14,306,810 V445D probably benign Het
Hells CT C 19: 38,953,601 probably null Het
Hnrnpr T G 4: 136,332,480 D197E possibly damaging Het
Hspb1 G A 5: 135,888,074 V6M probably damaging Het
Iglon5 A G 7: 43,476,891 V196A probably benign Het
Ints2 T C 11: 86,212,894 T1142A probably benign Het
Kcnq2 T A 2: 181,082,451 D587V probably damaging Het
Lmln C T 16: 33,080,960 P242L probably damaging Het
Mapt G A 11: 104,282,481 probably null Het
Mrgpre T C 7: 143,781,265 Y167C Het
Mtx2 A T 2: 74,869,352 I156F probably benign Het
Nipbl A T 15: 8,351,620 S563T probably benign Het
Nmbr C T 10: 14,770,453 S357L probably benign Het
Olfr1192-ps1 C T 2: 88,652,964 L271F possibly damaging Het
Olfr1306 T A 2: 111,912,862 I23F probably benign Het
Olfr1313 T C 2: 112,072,457 N42S probably damaging Het
Olfr1338 A T 4: 118,754,397 I49N possibly damaging Het
Olfr1508 A C 14: 52,463,235 I258S probably damaging Het
Olfr725 A C 14: 50,035,145 L86R probably damaging Het
Pctp A G 11: 89,984,728 M203T possibly damaging Het
Pip4k2c A G 10: 127,200,215 V261A probably benign Het
Pm20d1 G T 1: 131,812,047 V378F possibly damaging Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Sdk1 A G 5: 142,096,843 E1332G probably damaging Het
Sgce G T 6: 4,730,027 L66M probably benign Het
Sycp2l G T 13: 41,124,046 probably null Het
Tars G T 15: 11,384,097 H695N probably benign Het
Tdo2 A G 3: 81,969,544 V107A probably benign Het
Tmem131l A T 3: 83,898,486 M1550K possibly damaging Het
Ttf2 A C 3: 100,961,726 S431R probably benign Het
Unc80 A G 1: 66,473,309 D126G possibly damaging Het
Usp17lb C T 7: 104,841,376 V115I possibly damaging Het
Vezf1 A G 11: 88,081,727 T305A probably benign Het
Vmn1r45 A T 6: 89,933,894 N31K probably benign Het
Wdr59 T C 8: 111,485,176 K380E probably benign Het
Xylt1 T A 7: 117,634,744 Y499* probably null Het
Zfp777 T C 6: 48,029,191 E467G probably benign Het
Zkscan4 C A 13: 21,484,510 P406Q probably benign Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43370823 critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43366735 missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43342471 missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43356982 nonsense probably null
R8218:Atp8b5 UTSW 4 43372728 critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43366072 missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43291714 missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43342439 missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43304687 missense
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43361903 missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43370669 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACCCCAGTGTGACAGTCTAG -3'
(R):5'- TGGATCCGTGATCAGTGACTC -3'

Sequencing Primer
(F):5'- TCTAGAAAATGTGCACCTGTGGC -3'
(R):5'- TTGCAGTATTCAGCACTCCACAG -3'
Posted On2021-08-31