Incidental Mutation 'R8942:Hnrnpr'
ID 681032
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Name heterogeneous nuclear ribonucleoprotein R
Synonyms hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8942 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 136310942-136359447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 136332480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 197 (D197E)
Ref Sequence ENSEMBL: ENSMUSP00000138263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843]
AlphaFold Q8VHM5
Predicted Effect possibly damaging
Transcript: ENSMUST00000084219
AA Change: D197E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: D197E

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105850
AA Change: D298E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: D298E

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131671
AA Change: D197E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: D197E

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134524
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: D298E

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,320 D833E probably damaging Het
Adgrl3 A T 5: 81,648,721 I626L probably benign Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Atp2b2 G T 6: 113,814,030 Q138K probably benign Het
Atp8b5 T C 4: 43,353,658 F491L probably damaging Het
Bcap29 T A 12: 31,634,354 M1L probably damaging Het
C1qtnf7 A G 5: 43,616,241 D294G probably benign Het
Ccdc170 C T 10: 4,534,044 A290V probably benign Het
Cfhr2 A T 1: 139,813,554 L228I probably benign Het
Clip4 T A 17: 71,863,773 V645D probably benign Het
Cyp4a31 C T 4: 115,569,721 R173W possibly damaging Het
D430042O09Rik T G 7: 125,850,803 L1013R probably damaging Het
Dis3l T C 9: 64,307,593 K898R probably benign Het
Efr3b G T 12: 3,982,091 H172Q possibly damaging Het
Eipr1 A T 12: 28,867,054 N374Y probably damaging Het
Exoc3l4 A T 12: 111,425,568 E414D possibly damaging Het
Exoc3l4 G T 12: 111,425,569 V415L probably benign Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Gapvd1 T C 2: 34,729,122 T80A probably benign Het
Gen1 A G 12: 11,242,286 S501P probably benign Het
Gm10643 A G 8: 84,064,170 probably benign Het
Gm13084 T C 4: 143,810,291 N490S probably benign Het
Hecw1 A T 13: 14,306,810 V445D probably benign Het
Hells CT C 19: 38,953,601 probably null Het
Hspb1 G A 5: 135,888,074 V6M probably damaging Het
Iglon5 A G 7: 43,476,891 V196A probably benign Het
Ints2 T C 11: 86,212,894 T1142A probably benign Het
Kcnq2 T A 2: 181,082,451 D587V probably damaging Het
Lmln C T 16: 33,080,960 P242L probably damaging Het
Mapt G A 11: 104,282,481 probably null Het
Mrgpre T C 7: 143,781,265 Y167C Het
Mtx2 A T 2: 74,869,352 I156F probably benign Het
Nipbl A T 15: 8,351,620 S563T probably benign Het
Nmbr C T 10: 14,770,453 S357L probably benign Het
Olfr1192-ps1 C T 2: 88,652,964 L271F possibly damaging Het
Olfr1306 T A 2: 111,912,862 I23F probably benign Het
Olfr1313 T C 2: 112,072,457 N42S probably damaging Het
Olfr1338 A T 4: 118,754,397 I49N possibly damaging Het
Olfr1508 A C 14: 52,463,235 I258S probably damaging Het
Olfr725 A C 14: 50,035,145 L86R probably damaging Het
Pctp A G 11: 89,984,728 M203T possibly damaging Het
Pip4k2c A G 10: 127,200,215 V261A probably benign Het
Pm20d1 G T 1: 131,812,047 V378F possibly damaging Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Sdk1 A G 5: 142,096,843 E1332G probably damaging Het
Sgce G T 6: 4,730,027 L66M probably benign Het
Sycp2l G T 13: 41,124,046 probably null Het
Tars G T 15: 11,384,097 H695N probably benign Het
Tdo2 A G 3: 81,969,544 V107A probably benign Het
Tmem131l A T 3: 83,898,486 M1550K possibly damaging Het
Ttf2 A C 3: 100,961,726 S431R probably benign Het
Unc80 A G 1: 66,473,309 D126G possibly damaging Het
Usp17lb C T 7: 104,841,376 V115I possibly damaging Het
Vezf1 A G 11: 88,081,727 T305A probably benign Het
Vmn1r45 A T 6: 89,933,894 N31K probably benign Het
Wdr59 T C 8: 111,485,176 K380E probably benign Het
Xylt1 T A 7: 117,634,744 Y499* probably null Het
Zfp777 T C 6: 48,029,191 E467G probably benign Het
Zkscan4 C A 13: 21,484,510 P406Q probably benign Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136317148 missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136336298 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7067:Hnrnpr UTSW 4 136327393 missense probably damaging 1.00
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136317175 unclassified probably benign
R9008:Hnrnpr UTSW 4 136329426 missense probably damaging 0.97
R9502:Hnrnpr UTSW 4 136329370 missense probably damaging 0.99
R9515:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
R9516:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAACTCTGCATCGAGTAATG -3'
(R):5'- TACCGGGTTAGTGCTGCATC -3'

Sequencing Primer
(F):5'- ACTGTTGGGAGGCTTCTTCAGTC -3'
(R):5'- CATCAGCTACTTTTTGCTTTTCTAAG -3'
Posted On 2021-08-31