Incidental Mutation 'R8942:Ints2'
ID 681054
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8942 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86212894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1142 (T1142A)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T1142A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T1142A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T1142A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T1142A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,320 D833E probably damaging Het
Adgrl3 A T 5: 81,648,721 I626L probably benign Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Atp2b2 G T 6: 113,814,030 Q138K probably benign Het
Atp8b5 T C 4: 43,353,658 F491L probably damaging Het
Bcap29 T A 12: 31,634,354 M1L probably damaging Het
C1qtnf7 A G 5: 43,616,241 D294G probably benign Het
Ccdc170 C T 10: 4,534,044 A290V probably benign Het
Cfhr2 A T 1: 139,813,554 L228I probably benign Het
Clip4 T A 17: 71,863,773 V645D probably benign Het
Cyp4a31 C T 4: 115,569,721 R173W possibly damaging Het
D430042O09Rik T G 7: 125,850,803 L1013R probably damaging Het
Dis3l T C 9: 64,307,593 K898R probably benign Het
Efr3b G T 12: 3,982,091 H172Q possibly damaging Het
Eipr1 A T 12: 28,867,054 N374Y probably damaging Het
Exoc3l4 A T 12: 111,425,568 E414D possibly damaging Het
Exoc3l4 G T 12: 111,425,569 V415L probably benign Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Gapvd1 T C 2: 34,729,122 T80A probably benign Het
Gen1 A G 12: 11,242,286 S501P probably benign Het
Gm10643 A G 8: 84,064,170 probably benign Het
Gm13084 T C 4: 143,810,291 N490S probably benign Het
Hecw1 A T 13: 14,306,810 V445D probably benign Het
Hells CT C 19: 38,953,601 probably null Het
Hnrnpr T G 4: 136,332,480 D197E possibly damaging Het
Hspb1 G A 5: 135,888,074 V6M probably damaging Het
Iglon5 A G 7: 43,476,891 V196A probably benign Het
Kcnq2 T A 2: 181,082,451 D587V probably damaging Het
Lmln C T 16: 33,080,960 P242L probably damaging Het
Mapt G A 11: 104,282,481 probably null Het
Mrgpre T C 7: 143,781,265 Y167C Het
Mtx2 A T 2: 74,869,352 I156F probably benign Het
Nipbl A T 15: 8,351,620 S563T probably benign Het
Nmbr C T 10: 14,770,453 S357L probably benign Het
Olfr1192-ps1 C T 2: 88,652,964 L271F possibly damaging Het
Olfr1306 T A 2: 111,912,862 I23F probably benign Het
Olfr1313 T C 2: 112,072,457 N42S probably damaging Het
Olfr1338 A T 4: 118,754,397 I49N possibly damaging Het
Olfr1508 A C 14: 52,463,235 I258S probably damaging Het
Olfr725 A C 14: 50,035,145 L86R probably damaging Het
Pctp A G 11: 89,984,728 M203T possibly damaging Het
Pip4k2c A G 10: 127,200,215 V261A probably benign Het
Pm20d1 G T 1: 131,812,047 V378F possibly damaging Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Sdk1 A G 5: 142,096,843 E1332G probably damaging Het
Sgce G T 6: 4,730,027 L66M probably benign Het
Sycp2l G T 13: 41,124,046 probably null Het
Tars G T 15: 11,384,097 H695N probably benign Het
Tdo2 A G 3: 81,969,544 V107A probably benign Het
Tmem131l A T 3: 83,898,486 M1550K possibly damaging Het
Ttf2 A C 3: 100,961,726 S431R probably benign Het
Unc80 A G 1: 66,473,309 D126G possibly damaging Het
Usp17lb C T 7: 104,841,376 V115I possibly damaging Het
Vezf1 A G 11: 88,081,727 T305A probably benign Het
Vmn1r45 A T 6: 89,933,894 N31K probably benign Het
Wdr59 T C 8: 111,485,176 K380E probably benign Het
Xylt1 T A 7: 117,634,744 Y499* probably null Het
Zfp777 T C 6: 48,029,191 E467G probably benign Het
Zkscan4 C A 13: 21,484,510 P406Q probably benign Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R9037:Ints2 UTSW 11 86215704 missense probably benign
R9154:Ints2 UTSW 11 86234698 missense probably damaging 1.00
R9397:Ints2 UTSW 11 86244485 missense probably benign 0.01
R9412:Ints2 UTSW 11 86226763 missense probably damaging 0.99
R9472:Ints2 UTSW 11 86242998 missense
R9476:Ints2 UTSW 11 86244509 missense probably benign
R9510:Ints2 UTSW 11 86244509 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTTCAATACAATGACAGAGCTG -3'
(R):5'- TTCCCACCAGTTCTGACACAAG -3'

Sequencing Primer
(F):5'- GGACATCAGGATCCATGCTTC -3'
(R):5'- GTTCTGACACAAGCTAAGCGGTAC -3'
Posted On 2021-08-31