Incidental Mutation 'R8942:Ints2'
ID 681054
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8942 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86103720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1142 (T1142A)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T1142A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T1142A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T1142A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T1142A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,790,732 (GRCm39) D833E probably damaging Het
Adgrl3 A T 5: 81,796,568 (GRCm39) I626L probably benign Het
AI182371 A C 2: 34,990,622 (GRCm39) L25R probably damaging Het
Atp2b2 G T 6: 113,790,991 (GRCm39) Q138K probably benign Het
Atp8b5 T C 4: 43,353,658 (GRCm39) F491L probably damaging Het
Bcap29 T A 12: 31,684,353 (GRCm39) M1L probably damaging Het
C1qtnf7 A G 5: 43,773,583 (GRCm39) D294G probably benign Het
Ccdc170 C T 10: 4,484,044 (GRCm39) A290V probably benign Het
Cfhr2 A T 1: 139,741,292 (GRCm39) L228I probably benign Het
Clip4 T A 17: 72,170,768 (GRCm39) V645D probably benign Het
Cyp4a31 C T 4: 115,426,918 (GRCm39) R173W possibly damaging Het
Dis3l T C 9: 64,214,875 (GRCm39) K898R probably benign Het
Efr3b G T 12: 4,032,091 (GRCm39) H172Q possibly damaging Het
Eipr1 A T 12: 28,917,053 (GRCm39) N374Y probably damaging Het
Exoc3l4 A T 12: 111,392,002 (GRCm39) E414D possibly damaging Het
Exoc3l4 G T 12: 111,392,003 (GRCm39) V415L probably benign Het
Faap100 G T 11: 120,267,856 (GRCm39) H306N possibly damaging Het
Gapvd1 T C 2: 34,619,134 (GRCm39) T80A probably benign Het
Gen1 A G 12: 11,292,287 (GRCm39) S501P probably benign Het
Gm10643 A G 8: 84,790,799 (GRCm39) probably benign Het
Hecw1 A T 13: 14,481,395 (GRCm39) V445D probably benign Het
Hells CT C 19: 38,942,045 (GRCm39) probably null Het
Hnrnpr T G 4: 136,059,791 (GRCm39) D197E possibly damaging Het
Hspb1 G A 5: 135,916,928 (GRCm39) V6M probably damaging Het
Iglon5 A G 7: 43,126,315 (GRCm39) V196A probably benign Het
Katnip T G 7: 125,449,975 (GRCm39) L1013R probably damaging Het
Kcnq2 T A 2: 180,724,244 (GRCm39) D587V probably damaging Het
Lmln C T 16: 32,901,330 (GRCm39) P242L probably damaging Het
Mapt G A 11: 104,173,307 (GRCm39) probably null Het
Mrgpre T C 7: 143,335,002 (GRCm39) Y167C Het
Mtx2 A T 2: 74,699,696 (GRCm39) I156F probably benign Het
Nipbl A T 15: 8,381,104 (GRCm39) S563T probably benign Het
Nmbr C T 10: 14,646,197 (GRCm39) S357L probably benign Het
Or10ak14 A T 4: 118,611,594 (GRCm39) I49N possibly damaging Het
Or4e1 A C 14: 52,700,692 (GRCm39) I258S probably damaging Het
Or4f14 T A 2: 111,743,207 (GRCm39) I23F probably benign Het
Or4f60 T C 2: 111,902,802 (GRCm39) N42S probably damaging Het
Or4k15b A C 14: 50,272,602 (GRCm39) L86R probably damaging Het
Or4p4 C T 2: 88,483,308 (GRCm39) L271F possibly damaging Het
Pctp A G 11: 89,875,554 (GRCm39) M203T possibly damaging Het
Pip4k2c A G 10: 127,036,084 (GRCm39) V261A probably benign Het
Pm20d1 G T 1: 131,739,785 (GRCm39) V378F possibly damaging Het
Ppcdc C T 9: 57,342,265 (GRCm39) R19H probably benign Het
Pramel26 T C 4: 143,536,861 (GRCm39) N490S probably benign Het
Sdk1 A G 5: 142,082,598 (GRCm39) E1332G probably damaging Het
Sgce G T 6: 4,730,027 (GRCm39) L66M probably benign Het
Sycp2l G T 13: 41,277,522 (GRCm39) probably null Het
Tars1 G T 15: 11,384,183 (GRCm39) H695N probably benign Het
Tdo2 A G 3: 81,876,851 (GRCm39) V107A probably benign Het
Tmem131l A T 3: 83,805,793 (GRCm39) M1550K possibly damaging Het
Ttf2 A C 3: 100,869,042 (GRCm39) S431R probably benign Het
Unc80 A G 1: 66,512,468 (GRCm39) D126G possibly damaging Het
Usp17lb C T 7: 104,490,583 (GRCm39) V115I possibly damaging Het
Vezf1 A G 11: 87,972,553 (GRCm39) T305A probably benign Het
Vmn1r45 A T 6: 89,910,876 (GRCm39) N31K probably benign Het
Wdr59 T C 8: 112,211,808 (GRCm39) K380E probably benign Het
Xylt1 T A 7: 117,233,971 (GRCm39) Y499* probably null Het
Zfp777 T C 6: 48,006,125 (GRCm39) E467G probably benign Het
Zkscan4 C A 13: 21,668,680 (GRCm39) P406Q probably benign Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTTCAATACAATGACAGAGCTG -3'
(R):5'- TTCCCACCAGTTCTGACACAAG -3'

Sequencing Primer
(F):5'- GGACATCAGGATCCATGCTTC -3'
(R):5'- GTTCTGACACAAGCTAAGCGGTAC -3'
Posted On 2021-08-31