Incidental Mutation 'R8942:Exoc3l4'
ID681064
Institutional Source Beutler Lab
Gene Symbol Exoc3l4
Ensembl Gene ENSMUSG00000021280
Gene Nameexocyst complex component 3-like 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8942 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111417017-111431678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111425569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 415 (V415L)
Ref Sequence ENSEMBL: ENSMUSP00000152337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072646] [ENSMUST00000220537] [ENSMUST00000220852] [ENSMUST00000221144] [ENSMUST00000222437] [ENSMUST00000222897] [ENSMUST00000223050] [ENSMUST00000223431]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072646
AA Change: V415L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072438
Gene: ENSMUSG00000021280
AA Change: V415L

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Sec6 181 708 7.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220537
Predicted Effect probably benign
Transcript: ENSMUST00000220852
Predicted Effect probably benign
Transcript: ENSMUST00000221144
Predicted Effect probably benign
Transcript: ENSMUST00000222437
Predicted Effect probably benign
Transcript: ENSMUST00000222897
AA Change: V415L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223050
AA Change: V415L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223431
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,320 D833E probably damaging Het
Adgrl3 A T 5: 81,648,721 I626L probably benign Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Atp2b2 G T 6: 113,814,030 Q138K probably benign Het
Atp8b5 T C 4: 43,353,658 F491L probably damaging Het
Bcap29 T A 12: 31,634,354 M1L probably damaging Het
C1qtnf7 A G 5: 43,616,241 D294G probably benign Het
Ccdc170 C T 10: 4,534,044 A290V probably benign Het
Cfhr2 A T 1: 139,813,554 L228I probably benign Het
Clip4 T A 17: 71,863,773 V645D probably benign Het
Cyp4a31 C T 4: 115,569,721 R173W possibly damaging Het
D430042O09Rik T G 7: 125,850,803 L1013R probably damaging Het
Dis3l T C 9: 64,307,593 K898R probably benign Het
Efr3b G T 12: 3,982,091 H172Q possibly damaging Het
Eipr1 A T 12: 28,867,054 N374Y probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Gapvd1 T C 2: 34,729,122 T80A probably benign Het
Gen1 A G 12: 11,242,286 S501P probably benign Het
Gm10643 A G 8: 84,064,170 probably benign Het
Gm13084 T C 4: 143,810,291 N490S probably benign Het
Hecw1 A T 13: 14,306,810 V445D probably benign Het
Hells CT C 19: 38,953,601 probably null Het
Hnrnpr T G 4: 136,332,480 D197E possibly damaging Het
Hspb1 G A 5: 135,888,074 V6M probably damaging Het
Iglon5 A G 7: 43,476,891 V196A probably benign Het
Ints2 T C 11: 86,212,894 T1142A probably benign Het
Kcnq2 T A 2: 181,082,451 D587V probably damaging Het
Lmln C T 16: 33,080,960 P242L probably damaging Het
Mapt G A 11: 104,282,481 probably null Het
Mrgpre T C 7: 143,781,265 Y167C Het
Mtx2 A T 2: 74,869,352 I156F probably benign Het
Nipbl A T 15: 8,351,620 S563T probably benign Het
Nmbr C T 10: 14,770,453 S357L probably benign Het
Olfr1192-ps1 C T 2: 88,652,964 L271F possibly damaging Het
Olfr1306 T A 2: 111,912,862 I23F probably benign Het
Olfr1313 T C 2: 112,072,457 N42S probably damaging Het
Olfr1338 A T 4: 118,754,397 I49N possibly damaging Het
Olfr1508 A C 14: 52,463,235 I258S probably damaging Het
Olfr725 A C 14: 50,035,145 L86R probably damaging Het
Pctp A G 11: 89,984,728 M203T possibly damaging Het
Pip4k2c A G 10: 127,200,215 V261A probably benign Het
Pm20d1 G T 1: 131,812,047 V378F possibly damaging Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Sdk1 A G 5: 142,096,843 E1332G probably damaging Het
Sgce G T 6: 4,730,027 L66M probably benign Het
Sycp2l G T 13: 41,124,046 probably null Het
Tars G T 15: 11,384,097 H695N probably benign Het
Tdo2 A G 3: 81,969,544 V107A probably benign Het
Tmem131l A T 3: 83,898,486 M1550K possibly damaging Het
Ttf2 A C 3: 100,961,726 S431R probably benign Het
Unc80 A G 1: 66,473,309 D126G possibly damaging Het
Usp17lb C T 7: 104,841,376 V115I possibly damaging Het
Vezf1 A G 11: 88,081,727 T305A probably benign Het
Vmn1r45 A T 6: 89,933,894 N31K probably benign Het
Wdr59 T C 8: 111,485,176 K380E probably benign Het
Xylt1 T A 7: 117,634,744 Y499* probably null Het
Zfp777 T C 6: 48,029,191 E467G probably benign Het
Zkscan4 C A 13: 21,484,510 P406Q probably benign Het
Other mutations in Exoc3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Exoc3l4 APN 12 111429411 splice site probably benign
IGL02048:Exoc3l4 APN 12 111428483 missense probably benign 0.00
IGL03049:Exoc3l4 APN 12 111423401 missense probably damaging 0.96
IGL03069:Exoc3l4 APN 12 111424023 missense probably damaging 1.00
IGL03123:Exoc3l4 APN 12 111422113 missense probably damaging 1.00
R0631:Exoc3l4 UTSW 12 111427966 missense probably benign 0.34
R1377:Exoc3l4 UTSW 12 111428670 missense probably damaging 1.00
R2223:Exoc3l4 UTSW 12 111426152 missense possibly damaging 0.73
R2402:Exoc3l4 UTSW 12 111422256 missense possibly damaging 0.94
R2884:Exoc3l4 UTSW 12 111428522 missense possibly damaging 0.93
R3770:Exoc3l4 UTSW 12 111425555 missense probably benign
R4843:Exoc3l4 UTSW 12 111428053 intron probably benign
R4903:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4964:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4966:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R5082:Exoc3l4 UTSW 12 111427990 missense probably benign 0.04
R5152:Exoc3l4 UTSW 12 111430893 utr 3 prime probably benign
R5210:Exoc3l4 UTSW 12 111428841 intron probably benign
R5667:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5671:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5712:Exoc3l4 UTSW 12 111424042 nonsense probably null
R5873:Exoc3l4 UTSW 12 111423416 missense probably damaging 1.00
R5947:Exoc3l4 UTSW 12 111422401 missense possibly damaging 0.94
R6299:Exoc3l4 UTSW 12 111422079 start codon destroyed possibly damaging 0.59
R6332:Exoc3l4 UTSW 12 111427968 missense possibly damaging 0.79
R6489:Exoc3l4 UTSW 12 111428697 missense probably damaging 1.00
R7225:Exoc3l4 UTSW 12 111423624 missense probably benign 0.10
R7643:Exoc3l4 UTSW 12 111421935 intron probably benign
R7731:Exoc3l4 UTSW 12 111430748 missense possibly damaging 0.94
R7791:Exoc3l4 UTSW 12 111423540 missense probably damaging 1.00
R8723:Exoc3l4 UTSW 12 111430658 splice site probably benign
R8942:Exoc3l4 UTSW 12 111425568 missense possibly damaging 0.53
R9145:Exoc3l4 UTSW 12 111422152 missense not run
Z1088:Exoc3l4 UTSW 12 111429487 missense probably benign 0.29
Z1176:Exoc3l4 UTSW 12 111423720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCGATGGACCATGACTG -3'
(R):5'- AGAGCTGTGATTTAACCTGGCC -3'

Sequencing Primer
(F):5'- ATGGACCATGACTGGAGTCC -3'
(R):5'- CATGTGCCCCAAGAGTCTAG -3'
Posted On2021-08-31