Incidental Mutation 'R8943:Capn10'
ID 681076
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Name calpain 10
Synonyms Capn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R8943 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 92934376-92947941 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92943732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 351 (S351P)
Ref Sequence ENSEMBL: ENSMUSP00000122158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000117814] [ENSMUST00000152983]
AlphaFold Q9ESK3
Predicted Effect probably damaging
Transcript: ENSMUST00000027488
AA Change: S351P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: S351P

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117814
SMART Domains Protein: ENSMUSP00000112831
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 263 1.29e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152983
AA Change: S351P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270
AA Change: S351P

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187342
Meta Mutation Damage Score 0.7551 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,243 S457P probably damaging Het
Aak1 A G 6: 86,987,252 N945S unknown Het
Actr1a C A 19: 46,380,999 R192L possibly damaging Het
Adgrl2 T A 3: 148,828,483 N1036I probably damaging Het
Ak5 A G 3: 152,655,874 V137A probably damaging Het
Aldh1a2 T C 9: 71,261,773 V179A probably damaging Het
Ap2b1 A T 11: 83,346,753 I548F probably damaging Het
Arhgef10l A G 4: 140,565,239 Y352H probably damaging Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Atoh7 A G 10: 63,100,159 K2E possibly damaging Het
BC061237 A G 14: 44,504,201 I134V probably benign Het
Cadm1 T C 9: 47,789,838 I141T probably damaging Het
Cct6b T C 11: 82,764,133 probably benign Het
Cd19 T C 7: 126,412,158 T284A probably benign Het
Cfap53 A G 18: 74,299,182 Y47C probably damaging Het
Cldn18 T C 9: 99,696,109 M194V probably benign Het
Dgkb T A 12: 38,602,778 Y721N probably damaging Het
Dmbt1 A G 7: 131,119,643 Q1880R possibly damaging Het
Dock2 T C 11: 34,708,819 N311S possibly damaging Het
Dpysl5 G T 5: 30,778,031 M159I probably benign Het
Eif2b3 G A 4: 117,044,581 G147E probably damaging Het
Fam193a A G 5: 34,440,452 D531G probably benign Het
Fndc3b T C 3: 27,501,180 probably benign Het
Foxe3 C A 4: 114,925,326 A230S unknown Het
Gm14548 T C 7: 3,895,366 E319G probably benign Het
Gm5591 A T 7: 38,520,303 V382E probably benign Het
Gm7995 A T 14: 42,310,271 N21I probably damaging Het
Ipo8 G A 6: 148,775,049 P981S probably benign Het
Kcnh8 A G 17: 52,797,458 D161G probably benign Het
Krt71 A G 15: 101,736,745 I377T possibly damaging Het
Krt75 A T 15: 101,568,332 M374K probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lpcat1 A G 13: 73,513,910 T409A probably benign Het
Lrch1 A T 14: 74,795,368 I514K probably benign Het
Mc4r A C 18: 66,860,039 M1R probably null Het
Mthfd1l A T 10: 4,028,466 H442L probably damaging Het
Olfr1166 T A 2: 88,124,374 I204F probably damaging Het
Pdcd1lg2 T C 19: 29,446,153 M199T probably benign Het
Pigg G A 5: 108,336,200 V438M probably damaging Het
Ppfibp1 T A 6: 147,019,183 probably null Het
Rbm15 T A 3: 107,332,056 Y342F possibly damaging Het
Rhbdl1 A T 17: 25,835,142 V278E probably damaging Het
Ryr3 T C 2: 112,635,324 N4781S probably damaging Het
Scn7a A T 2: 66,694,862 silent Het
Sfswap A G 5: 129,504,104 R114G probably damaging Het
Sohlh2 C A 3: 55,196,861 A258D possibly damaging Het
Sstr4 T A 2: 148,395,862 V131D possibly damaging Het
Tenm2 T C 11: 36,944,034 T45A probably damaging Het
Tmem131l A T 3: 83,924,172 F818I probably damaging Het
Trappc6b A G 12: 59,050,363 F58L probably damaging Het
Vmn1r229 A T 17: 20,815,156 H221L possibly damaging Het
Vmn1r33 T A 6: 66,611,799 Y257F probably damaging Het
Wdfy3 T C 5: 101,845,365 probably benign Het
Zfp446 C T 7: 12,979,637 Q177* probably null Het
Zufsp A G 10: 33,919,305 *552Q probably null Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1653:Capn10 UTSW 1 92946898 missense probably damaging 1.00
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
R7495:Capn10 UTSW 1 92943370 missense probably damaging 1.00
R8170:Capn10 UTSW 1 92934964 missense probably damaging 0.98
R8393:Capn10 UTSW 1 92943408 missense probably benign 0.09
R9303:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9305:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9655:Capn10 UTSW 1 92939389 missense probably damaging 1.00
R9776:Capn10 UTSW 1 92943864 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCTGCCTGATTGACTGACTG -3'
(R):5'- CCACAGCCTGGTAGTCTTTG -3'

Sequencing Primer
(F):5'- ACTGACTGGGGGTTTGGAG -3'
(R):5'- CTTTGCCTGGGAGGTTCACC -3'
Posted On 2021-08-31