Incidental Mutation 'R8943:Sstr4'
ID 681079
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R8943 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 148395344-148396767 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148395862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 131 (V131D)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000109962
AA Change: V131D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: V131D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,243 S457P probably damaging Het
Aak1 A G 6: 86,987,252 N945S unknown Het
Actr1a C A 19: 46,380,999 R192L possibly damaging Het
Adgrl2 T A 3: 148,828,483 N1036I probably damaging Het
Ak5 A G 3: 152,655,874 V137A probably damaging Het
Aldh1a2 T C 9: 71,261,773 V179A probably damaging Het
Ap2b1 A T 11: 83,346,753 I548F probably damaging Het
Arhgef10l A G 4: 140,565,239 Y352H probably damaging Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Atoh7 A G 10: 63,100,159 K2E possibly damaging Het
BC061237 A G 14: 44,504,201 I134V probably benign Het
Cadm1 T C 9: 47,789,838 I141T probably damaging Het
Capn10 T C 1: 92,943,732 S351P probably damaging Het
Cct6b T C 11: 82,764,133 probably benign Het
Cd19 T C 7: 126,412,158 T284A probably benign Het
Cfap53 A G 18: 74,299,182 Y47C probably damaging Het
Cldn18 T C 9: 99,696,109 M194V probably benign Het
Dgkb T A 12: 38,602,778 Y721N probably damaging Het
Dmbt1 A G 7: 131,119,643 Q1880R possibly damaging Het
Dock2 T C 11: 34,708,819 N311S possibly damaging Het
Dpysl5 G T 5: 30,778,031 M159I probably benign Het
Eif2b3 G A 4: 117,044,581 G147E probably damaging Het
Fam193a A G 5: 34,440,452 D531G probably benign Het
Fndc3b T C 3: 27,501,180 probably benign Het
Foxe3 C A 4: 114,925,326 A230S unknown Het
Gm14548 T C 7: 3,895,366 E319G probably benign Het
Gm5591 A T 7: 38,520,303 V382E probably benign Het
Gm7995 A T 14: 42,310,271 N21I probably damaging Het
Ipo8 G A 6: 148,775,049 P981S probably benign Het
Kcnh8 A G 17: 52,797,458 D161G probably benign Het
Krt71 A G 15: 101,736,745 I377T possibly damaging Het
Krt75 A T 15: 101,568,332 M374K probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lpcat1 A G 13: 73,513,910 T409A probably benign Het
Lrch1 A T 14: 74,795,368 I514K probably benign Het
Mc4r A C 18: 66,860,039 M1R probably null Het
Mthfd1l A T 10: 4,028,466 H442L probably damaging Het
Olfr1166 T A 2: 88,124,374 I204F probably damaging Het
Pdcd1lg2 T C 19: 29,446,153 M199T probably benign Het
Pigg G A 5: 108,336,200 V438M probably damaging Het
Ppfibp1 T A 6: 147,019,183 probably null Het
Rbm15 T A 3: 107,332,056 Y342F possibly damaging Het
Rhbdl1 A T 17: 25,835,142 V278E probably damaging Het
Ryr3 T C 2: 112,635,324 N4781S probably damaging Het
Scn7a A T 2: 66,694,862 silent Het
Sfswap A G 5: 129,504,104 R114G probably damaging Het
Sohlh2 C A 3: 55,196,861 A258D possibly damaging Het
Tenm2 T C 11: 36,944,034 T45A probably damaging Het
Tmem131l A T 3: 83,924,172 F818I probably damaging Het
Trappc6b A G 12: 59,050,363 F58L probably damaging Het
Vmn1r229 A T 17: 20,815,156 H221L possibly damaging Het
Vmn1r33 T A 6: 66,611,799 Y257F probably damaging Het
Wdfy3 T C 5: 101,845,365 probably benign Het
Zfp446 C T 7: 12,979,637 Q177* probably null Het
Zufsp A G 10: 33,919,305 *552Q probably null Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148395552 missense probably benign 0.00
IGL01536:Sstr4 APN 2 148395880 missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148396309 missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148396533 nonsense probably null
R0396:Sstr4 UTSW 2 148396261 missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148396359 missense probably benign 0.01
R1839:Sstr4 UTSW 2 148395533 missense probably benign 0.21
R2332:Sstr4 UTSW 2 148396410 missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148396165 missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148396353 missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148395551 small insertion probably benign
R5503:Sstr4 UTSW 2 148395551 small insertion probably benign
R5596:Sstr4 UTSW 2 148395732 missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148396083 missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148396249 missense probably damaging 0.97
R8939:Sstr4 UTSW 2 148396308 missense probably damaging 1.00
X0022:Sstr4 UTSW 2 148395532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAAGATGAAGACAGCC -3'
(R):5'- TAATCCGATGGCCAGAACCG -3'

Sequencing Primer
(F):5'- GATGAAGACAGCCACCAACATCTAC -3'
(R):5'- AGGCCAGTGCAGGTTGC -3'
Posted On 2021-08-31