Incidental Mutation 'R8943:Dpysl5'
ID 681088
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 068782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R8943 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30935375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 159 (M159I)
Ref Sequence ENSEMBL: ENSMUSP00000110377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably benign
Transcript: ENSMUST00000088081
AA Change: M159I

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: M159I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114729
AA Change: M159I

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: M159I

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,275,667 (GRCm39) S457P probably damaging Het
Aak1 A G 6: 86,964,234 (GRCm39) N945S unknown Het
Actr1a C A 19: 46,369,438 (GRCm39) R192L possibly damaging Het
Adgrl2 T A 3: 148,534,119 (GRCm39) N1036I probably damaging Het
Ak5 A G 3: 152,361,511 (GRCm39) V137A probably damaging Het
Aldh1a2 T C 9: 71,169,055 (GRCm39) V179A probably damaging Het
Ap2b1 A T 11: 83,237,579 (GRCm39) I548F probably damaging Het
Arhgef10l A G 4: 140,292,550 (GRCm39) Y352H probably damaging Het
Atad5 C T 11: 79,986,524 (GRCm39) T537M possibly damaging Het
Atoh7 A G 10: 62,935,938 (GRCm39) K2E possibly damaging Het
BC061237 A G 14: 44,741,658 (GRCm39) I134V probably benign Het
Cadm1 T C 9: 47,701,136 (GRCm39) I141T probably damaging Het
Capn10 T C 1: 92,871,454 (GRCm39) S351P probably damaging Het
Cct6b T C 11: 82,654,959 (GRCm39) probably benign Het
Cd19 T C 7: 126,011,330 (GRCm39) T284A probably benign Het
Cfap53 A G 18: 74,432,253 (GRCm39) Y47C probably damaging Het
Cldn18 T C 9: 99,578,162 (GRCm39) M194V probably benign Het
Dgkb T A 12: 38,652,777 (GRCm39) Y721N probably damaging Het
Dmbt1 A G 7: 130,721,372 (GRCm39) Q1880R possibly damaging Het
Dock2 T C 11: 34,599,646 (GRCm39) N311S possibly damaging Het
Eif2b3 G A 4: 116,901,778 (GRCm39) G147E probably damaging Het
Fam193a A G 5: 34,597,796 (GRCm39) D531G probably benign Het
Fndc3b T C 3: 27,555,329 (GRCm39) probably benign Het
Foxe3 C A 4: 114,782,523 (GRCm39) A230S unknown Het
Gm5591 A T 7: 38,219,727 (GRCm39) V382E probably benign Het
Gm7995 A T 14: 42,132,228 (GRCm39) N21I probably damaging Het
Ipo8 G A 6: 148,676,547 (GRCm39) P981S probably benign Het
Kcnh8 A G 17: 53,104,486 (GRCm39) D161G probably benign Het
Krt71 A G 15: 101,645,180 (GRCm39) I377T possibly damaging Het
Krt75 A T 15: 101,476,767 (GRCm39) M374K probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Lpcat1 A G 13: 73,662,029 (GRCm39) T409A probably benign Het
Lrch1 A T 14: 75,032,808 (GRCm39) I514K probably benign Het
Mc4r A C 18: 66,993,110 (GRCm39) M1R probably null Het
Mthfd1l A T 10: 3,978,466 (GRCm39) H442L probably damaging Het
Or5d38 T A 2: 87,954,718 (GRCm39) I204F probably damaging Het
Pdcd1lg2 T C 19: 29,423,553 (GRCm39) M199T probably benign Het
Pigg G A 5: 108,484,066 (GRCm39) V438M probably damaging Het
Pira12 T C 7: 3,898,365 (GRCm39) E319G probably benign Het
Ppfibp1 T A 6: 146,920,681 (GRCm39) probably null Het
Rbm15 T A 3: 107,239,372 (GRCm39) Y342F possibly damaging Het
Rhbdl1 A T 17: 26,054,116 (GRCm39) V278E probably damaging Het
Ryr3 T C 2: 112,465,669 (GRCm39) N4781S probably damaging Het
Scn7a A T 2: 66,525,206 (GRCm39) silent Het
Sfswap A G 5: 129,581,168 (GRCm39) R114G probably damaging Het
Sohlh2 C A 3: 55,104,282 (GRCm39) A258D possibly damaging Het
Sstr4 T A 2: 148,237,782 (GRCm39) V131D possibly damaging Het
Tenm2 T C 11: 36,834,861 (GRCm39) T45A probably damaging Het
Tmem131l A T 3: 83,831,479 (GRCm39) F818I probably damaging Het
Trappc6b A G 12: 59,097,149 (GRCm39) F58L probably damaging Het
Vmn1r229 A T 17: 21,035,418 (GRCm39) H221L possibly damaging Het
Vmn1r33 T A 6: 66,588,783 (GRCm39) Y257F probably damaging Het
Wdfy3 T C 5: 101,993,231 (GRCm39) probably benign Het
Zfp446 C T 7: 12,713,564 (GRCm39) Q177* probably null Het
Zup1 A G 10: 33,795,301 (GRCm39) *552Q probably null Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGGTAGTACCGCTGAATG -3'
(R):5'- GCAGTATCCATTGGCTCTACCC -3'

Sequencing Primer
(F):5'- TGTACTGGGCATTCACAGCAC -3'
(R):5'- ATTGGCTCTACCCCCACAC -3'
Posted On 2021-08-31