Mutagenetix > Incidental Mutation

Incidental Mutation 'R8943:Ap2b1'

681112

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8943 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83346753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 548 (I548F)

Ref Sequence

ENSEMBL: ENSMUSP00000134779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: I548F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I548F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065692
AA Change: I548F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I548F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176430
AA Change: I548F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I548F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176523
AA Change: I510F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I510F

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

98% (50/51)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	C	7: 41,626,243	S457P	probably damaging	Het
Aak1	A	G	6: 86,987,252	N945S	unknown	Het
Actr1a	C	A	19: 46,380,999	R192L	possibly damaging	Het
Adgrl2	T	A	3: 148,828,483	N1036I	probably damaging	Het
Ak5	A	G	3: 152,655,874	V137A	probably damaging	Het
Aldh1a2	T	C	9: 71,261,773	V179A	probably damaging	Het
Arhgef10l	A	G	4: 140,565,239	Y352H	probably damaging	Het
Atad5	C	T	11: 80,095,698	T537M	possibly damaging	Het
Atoh7	A	G	10: 63,100,159	K2E	possibly damaging	Het
BC061237	A	G	14: 44,504,201	I134V	probably benign	Het
Cadm1	T	C	9: 47,789,838	I141T	probably damaging	Het
Capn10	T	C	1: 92,943,732	S351P	probably damaging	Het
Cct6b	T	C	11: 82,764,133		probably benign	Het
Cd19	T	C	7: 126,412,158	T284A	probably benign	Het
Cfap53	A	G	18: 74,299,182	Y47C	probably damaging	Het
Cldn18	T	C	9: 99,696,109	M194V	probably benign	Het
Dgkb	T	A	12: 38,602,778	Y721N	probably damaging	Het
Dmbt1	A	G	7: 131,119,643	Q1880R	possibly damaging	Het
Dock2	T	C	11: 34,708,819	N311S	possibly damaging	Het
Dpysl5	G	T	5: 30,778,031	M159I	probably benign	Het
Eif2b3	G	A	4: 117,044,581	G147E	probably damaging	Het
Fam193a	A	G	5: 34,440,452	D531G	probably benign	Het
Fndc3b	T	C	3: 27,501,180		probably benign	Het
Foxe3	C	A	4: 114,925,326	A230S	unknown	Het
Gm14548	T	C	7: 3,895,366	E319G	probably benign	Het
Gm5591	A	T	7: 38,520,303	V382E	probably benign	Het
Gm7995	A	T	14: 42,310,271	N21I	probably damaging	Het
Ipo8	G	A	6: 148,775,049	P981S	probably benign	Het
Kcnh8	A	G	17: 52,797,458	D161G	probably benign	Het
Krt71	A	G	15: 101,736,745	I377T	possibly damaging	Het
Krt75	A	T	15: 101,568,332	M374K	probably benign	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lpcat1	A	G	13: 73,513,910	T409A	probably benign	Het
Lrch1	A	T	14: 74,795,368	I514K	probably benign	Het
Mc4r	A	C	18: 66,860,039	M1R	probably null	Het
Mthfd1l	A	T	10: 4,028,466	H442L	probably damaging	Het
Olfr1166	T	A	2: 88,124,374	I204F	probably damaging	Het
Pdcd1lg2	T	C	19: 29,446,153	M199T	probably benign	Het
Pigg	G	A	5: 108,336,200	V438M	probably damaging	Het
Ppfibp1	T	A	6: 147,019,183		probably null	Het
Rbm15	T	A	3: 107,332,056	Y342F	possibly damaging	Het
Rhbdl1	A	T	17: 25,835,142	V278E	probably damaging	Het
Ryr3	T	C	2: 112,635,324	N4781S	probably damaging	Het
Scn7a	A	T	2: 66,694,862		silent	Het
Sfswap	A	G	5: 129,504,104	R114G	probably damaging	Het
Sohlh2	C	A	3: 55,196,861	A258D	possibly damaging	Het
Sstr4	T	A	2: 148,395,862	V131D	possibly damaging	Het
Tenm2	T	C	11: 36,944,034	T45A	probably damaging	Het
Tmem131l	A	T	3: 83,924,172	F818I	probably damaging	Het
Trappc6b	A	G	12: 59,050,363	F58L	probably damaging	Het
Vmn1r229	A	T	17: 20,815,156	H221L	possibly damaging	Het
Vmn1r33	T	A	6: 66,611,799	Y257F	probably damaging	Het
Wdfy3	T	C	5: 101,845,365		probably benign	Het
Zfp446	C	T	7: 12,979,637	Q177*	probably null	Het
Zufsp	A	G	10: 33,919,305	*552Q	probably null	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAAGTCGCTACCACAGTGCC -3'
(R):5'- GTGCCTAAACAGCAAGTCACTTC -3'

Sequencing Primer
(F):5'- TACCACAGTGCCATGACAGTAAG -3'
(R):5'- TTGCTGAAGAGACCTCCACCTG -3'

Posted On

2021-08-31