Incidental Mutation 'R8943:Ap2b1'
ID 681112
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 068782-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8943 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83237579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 548 (I548F)
Ref Sequence ENSEMBL: ENSMUSP00000134779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
AlphaFold Q9DBG3
Predicted Effect probably damaging
Transcript: ENSMUST00000018875
AA Change: I548F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I548F

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065692
AA Change: I548F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I548F

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176430
AA Change: I548F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I548F

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176523
AA Change: I510F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I510F

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,275,667 (GRCm39) S457P probably damaging Het
Aak1 A G 6: 86,964,234 (GRCm39) N945S unknown Het
Actr1a C A 19: 46,369,438 (GRCm39) R192L possibly damaging Het
Adgrl2 T A 3: 148,534,119 (GRCm39) N1036I probably damaging Het
Ak5 A G 3: 152,361,511 (GRCm39) V137A probably damaging Het
Aldh1a2 T C 9: 71,169,055 (GRCm39) V179A probably damaging Het
Arhgef10l A G 4: 140,292,550 (GRCm39) Y352H probably damaging Het
Atad5 C T 11: 79,986,524 (GRCm39) T537M possibly damaging Het
Atoh7 A G 10: 62,935,938 (GRCm39) K2E possibly damaging Het
BC061237 A G 14: 44,741,658 (GRCm39) I134V probably benign Het
Cadm1 T C 9: 47,701,136 (GRCm39) I141T probably damaging Het
Capn10 T C 1: 92,871,454 (GRCm39) S351P probably damaging Het
Cct6b T C 11: 82,654,959 (GRCm39) probably benign Het
Cd19 T C 7: 126,011,330 (GRCm39) T284A probably benign Het
Cfap53 A G 18: 74,432,253 (GRCm39) Y47C probably damaging Het
Cldn18 T C 9: 99,578,162 (GRCm39) M194V probably benign Het
Dgkb T A 12: 38,652,777 (GRCm39) Y721N probably damaging Het
Dmbt1 A G 7: 130,721,372 (GRCm39) Q1880R possibly damaging Het
Dock2 T C 11: 34,599,646 (GRCm39) N311S possibly damaging Het
Dpysl5 G T 5: 30,935,375 (GRCm39) M159I probably benign Het
Eif2b3 G A 4: 116,901,778 (GRCm39) G147E probably damaging Het
Fam193a A G 5: 34,597,796 (GRCm39) D531G probably benign Het
Fndc3b T C 3: 27,555,329 (GRCm39) probably benign Het
Foxe3 C A 4: 114,782,523 (GRCm39) A230S unknown Het
Gm5591 A T 7: 38,219,727 (GRCm39) V382E probably benign Het
Gm7995 A T 14: 42,132,228 (GRCm39) N21I probably damaging Het
Ipo8 G A 6: 148,676,547 (GRCm39) P981S probably benign Het
Kcnh8 A G 17: 53,104,486 (GRCm39) D161G probably benign Het
Krt71 A G 15: 101,645,180 (GRCm39) I377T possibly damaging Het
Krt75 A T 15: 101,476,767 (GRCm39) M374K probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Lpcat1 A G 13: 73,662,029 (GRCm39) T409A probably benign Het
Lrch1 A T 14: 75,032,808 (GRCm39) I514K probably benign Het
Mc4r A C 18: 66,993,110 (GRCm39) M1R probably null Het
Mthfd1l A T 10: 3,978,466 (GRCm39) H442L probably damaging Het
Or5d38 T A 2: 87,954,718 (GRCm39) I204F probably damaging Het
Pdcd1lg2 T C 19: 29,423,553 (GRCm39) M199T probably benign Het
Pigg G A 5: 108,484,066 (GRCm39) V438M probably damaging Het
Pira12 T C 7: 3,898,365 (GRCm39) E319G probably benign Het
Ppfibp1 T A 6: 146,920,681 (GRCm39) probably null Het
Rbm15 T A 3: 107,239,372 (GRCm39) Y342F possibly damaging Het
Rhbdl1 A T 17: 26,054,116 (GRCm39) V278E probably damaging Het
Ryr3 T C 2: 112,465,669 (GRCm39) N4781S probably damaging Het
Scn7a A T 2: 66,525,206 (GRCm39) silent Het
Sfswap A G 5: 129,581,168 (GRCm39) R114G probably damaging Het
Sohlh2 C A 3: 55,104,282 (GRCm39) A258D possibly damaging Het
Sstr4 T A 2: 148,237,782 (GRCm39) V131D possibly damaging Het
Tenm2 T C 11: 36,834,861 (GRCm39) T45A probably damaging Het
Tmem131l A T 3: 83,831,479 (GRCm39) F818I probably damaging Het
Trappc6b A G 12: 59,097,149 (GRCm39) F58L probably damaging Het
Vmn1r229 A T 17: 21,035,418 (GRCm39) H221L possibly damaging Het
Vmn1r33 T A 6: 66,588,783 (GRCm39) Y257F probably damaging Het
Wdfy3 T C 5: 101,993,231 (GRCm39) probably benign Het
Zfp446 C T 7: 12,713,564 (GRCm39) Q177* probably null Het
Zup1 A G 10: 33,795,301 (GRCm39) *552Q probably null Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAGTCGCTACCACAGTGCC -3'
(R):5'- GTGCCTAAACAGCAAGTCACTTC -3'

Sequencing Primer
(F):5'- TACCACAGTGCCATGACAGTAAG -3'
(R):5'- TTGCTGAAGAGACCTCCACCTG -3'
Posted On 2021-08-31