Incidental Mutation 'R8943:Krt9'
ID681113
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8943 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC at 100189077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect probably benign
Transcript: ENSMUST00000059707
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,243 S457P probably damaging Het
Aak1 A G 6: 86,987,252 N945S unknown Het
Actr1a C A 19: 46,380,999 R192L possibly damaging Het
Adgrl2 T A 3: 148,828,483 N1036I probably damaging Het
Ak5 A G 3: 152,655,874 V137A probably damaging Het
Aldh1a2 T C 9: 71,261,773 V179A probably damaging Het
Ap2b1 A T 11: 83,346,753 I548F probably damaging Het
Arhgef10l A G 4: 140,565,239 Y352H probably damaging Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Atoh7 A G 10: 63,100,159 K2E possibly damaging Het
BC061237 A G 14: 44,504,201 I134V probably benign Het
Cadm1 T C 9: 47,789,838 I141T probably damaging Het
Capn10 T C 1: 92,943,732 S351P probably damaging Het
Cct6b T C 11: 82,764,133 probably benign Het
Cd19 T C 7: 126,412,158 T284A probably benign Het
Cfap53 A G 18: 74,299,182 Y47C probably damaging Het
Cldn18 T C 9: 99,696,109 M194V probably benign Het
Dgkb T A 12: 38,602,778 Y721N probably damaging Het
Dmbt1 A G 7: 131,119,643 Q1880R possibly damaging Het
Dock2 T C 11: 34,708,819 N311S possibly damaging Het
Dpysl5 G T 5: 30,778,031 M159I probably benign Het
Eif2b3 G A 4: 117,044,581 G147E probably damaging Het
Fam193a A G 5: 34,440,452 D531G probably benign Het
Foxe3 C A 4: 114,925,326 A230S unknown Het
Gm14548 T C 7: 3,895,366 E319G probably benign Het
Gm5591 A T 7: 38,520,303 V382E probably benign Het
Gm7995 A T 14: 42,310,271 N21I probably damaging Het
Ipo8 G A 6: 148,775,049 P981S probably benign Het
Kcnh8 A G 17: 52,797,458 D161G probably benign Het
Krt71 A G 15: 101,736,745 I377T possibly damaging Het
Krt75 A T 15: 101,568,332 M374K probably benign Het
Lpcat1 A G 13: 73,513,910 T409A probably benign Het
Lrch1 A T 14: 74,795,368 I514K probably benign Het
Mc4r A C 18: 66,860,039 M1R probably null Het
Mthfd1l A T 10: 4,028,466 H442L probably damaging Het
Olfr1166 T A 2: 88,124,374 I204F probably damaging Het
Pdcd1lg2 T C 19: 29,446,153 M199T probably benign Het
Pigg G A 5: 108,336,200 V438M probably damaging Het
Ppfibp1 T A 6: 147,019,183 probably null Het
Rbm15 T A 3: 107,332,056 Y342F possibly damaging Het
Rhbdl1 A T 17: 25,835,142 V278E probably damaging Het
Ryr3 T C 2: 112,635,324 N4781S probably damaging Het
Sfswap A G 5: 129,504,104 R114G probably damaging Het
Sohlh2 C A 3: 55,196,861 A258D possibly damaging Het
Sstr4 T A 2: 148,395,862 V131D possibly damaging Het
Tenm2 T C 11: 36,944,034 T45A probably damaging Het
Tmem131l A T 3: 83,924,172 F818I probably damaging Het
Trappc6b A G 12: 59,050,363 F58L probably damaging Het
Vmn1r229 A T 17: 20,815,156 H221L possibly damaging Het
Vmn1r33 T A 6: 66,611,799 Y257F probably damaging Het
Zfp446 C T 7: 12,979,637 Q177* probably null Het
Zufsp A G 10: 33,919,305 *552Q probably null Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
droplet UTSW 11 100190788 missense probably damaging 1.00
G1citation:Krt9 UTSW 11 100189077 small deletion probably benign
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
R7805:Krt9 UTSW 11 100192696 missense possibly damaging 0.85
R7817:Krt9 UTSW 11 100189077 small deletion probably benign
R7822:Krt9 UTSW 11 100189077 small deletion probably benign
R7834:Krt9 UTSW 11 100192666 missense probably benign 0.06
R7947:Krt9 UTSW 11 100189077 small deletion probably benign
R7977:Krt9 UTSW 11 100189077 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCTGCTTCCTCCTCCATAA -3'
(R):5'- GGATGCCTCAGTTCACACTT -3'

Sequencing Primer
(F):5'- TAACCTCCTCCACTTTTTCCACCATG -3'
(R):5'- GGATGCCTCAGTTCACACTTAAGTC -3'
Posted On2021-08-31