Mutagenetix > Incidental Mutation

Incidental Mutation 'R0734:Cfap65'

68119

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

038915-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R0734 (G1)

Quality Score

137

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74918887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 954 (Y954F)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: Y954F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: Y954F

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Meta Mutation Damage Score

0.5583

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.0%
20x: 93.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	T	A	16: 4,850,334	S530T	probably benign	Het
Acer2	G	T	4: 86,917,559	K223N	probably benign	Het
Adam19	T	G	11: 46,127,403	C431G	probably damaging	Het
Adamts16	T	G	13: 70,738,481		probably benign	Het
Aox2	A	T	1: 58,305,341	E531V	probably benign	Het
Apaf1	A	T	10: 91,037,021	N720K	probably benign	Het
Atrnl1	T	A	19: 57,654,861	W394R	probably damaging	Het
Bcl6	T	C	16: 23,968,139	E634G	probably damaging	Het
Cobl	A	G	11: 12,375,971	V168A	probably damaging	Het
Cped1	C	T	6: 22,085,041	P210S	probably damaging	Het
Crb1	C	T	1: 139,337,084	V199M	probably benign	Het
Cyp2j6	A	T	4: 96,523,844		probably benign	Het
Dhrs3	C	G	4: 144,927,176	S289W	probably damaging	Het
Dido1	T	G	2: 180,660,042	Q2023P	probably benign	Het
Dlg4	G	A	11: 70,042,705	G550R	probably damaging	Het
Dnah12	C	A	14: 26,800,013	H1928N	probably benign	Het
Dthd1	A	C	5: 62,839,410		probably benign	Het
Erg	C	A	16: 95,370,025	G269C	possibly damaging	Het
Erich6	G	A	3: 58,629,388		probably benign	Het
F5	G	C	1: 164,198,917	R1686P	probably damaging	Het
Fancc	T	C	13: 63,331,842	R300G	probably damaging	Het
Fcer1g	T	A	1: 171,231,179	K47*	probably null	Het
Flt4	A	G	11: 49,626,717	T289A	possibly damaging	Het
Gcnt2	T	A	13: 40,860,521	F56Y	probably benign	Het
Gpatch8	G	T	11: 102,481,400	S437R	unknown	Het
Grin2a	T	A	16: 9,579,611	I871F	possibly damaging	Het
Hsd17b4	T	C	18: 50,170,777	V439A	possibly damaging	Het
Hykk	A	T	9: 54,946,432	K346M	possibly damaging	Het
Ifi208	T	C	1: 173,683,335	L352S	probably damaging	Het
Ikzf1	T	C	11: 11,758,195	V110A	probably damaging	Het
Irak3	A	T	10: 120,145,637		probably benign	Het
Lamp5	T	A	2: 136,059,030	V50E	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrch3	C	T	16: 32,997,483	R570*	probably null	Het
Map1lc3a	T	C	2: 155,276,976	V20A	possibly damaging	Het
Map3k14	C	A	11: 103,227,000	K655N	probably benign	Het
Mark2	A	G	19: 7,285,981		probably benign	Het
Mbtd1	G	A	11: 93,923,146	G205D	probably damaging	Het
Med13	T	C	11: 86,301,237	T861A	probably benign	Het
Meltf	T	A	16: 31,881,958	Y99N	probably damaging	Het
Mex3d	G	A	10: 80,381,532	T617I	possibly damaging	Het
Muc13	G	A	16: 33,803,082	V249I	probably damaging	Het
Myo18a	C	A	11: 77,847,404	P1688Q	probably damaging	Het
Naaladl1	A	T	19: 6,112,874		probably null	Het
Ncoa3	T	A	2: 166,069,191		probably benign	Het
Nf2	T	C	11: 4,820,409	T67A	probably benign	Het
Nin	A	G	12: 70,030,113	V1056A	probably benign	Het
Olfr1426	T	A	19: 12,088,119	R224S	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr59	A	T	11: 74,288,946	Q100L	probably damaging	Het
P3h1	T	C	4: 119,238,688	L331P	probably damaging	Het
Pabpc4l	T	C	3: 46,446,973	K79E	possibly damaging	Het
Pam	T	A	1: 97,864,362	R445*	probably null	Het
Pcdhb6	T	C	18: 37,335,334	I436T	probably damaging	Het
Piezo2	A	G	18: 63,041,723	Y1987H	probably damaging	Het
Plch2	G	A	4: 154,996,283	T477I	probably damaging	Het
Postn	G	A	3: 54,362,715	G72R	probably damaging	Het
Proca1	G	A	11: 78,201,802		probably benign	Het
Psip1	T	A	4: 83,463,588		probably benign	Het
Ptprd	G	A	4: 76,140,597	P153L	probably damaging	Het
Rgl1	T	C	1: 152,554,300	D242G	probably damaging	Het
Ric1	T	A	19: 29,594,818	I671K	possibly damaging	Het
Rxrg	T	A	1: 167,627,444	C199S	probably damaging	Het
Sec24c	A	C	14: 20,693,745	D1006A	probably damaging	Het
Sec63	A	G	10: 42,796,208	T173A	probably benign	Het
Sfxn5	T	C	6: 85,267,865		probably benign	Het
Spam1	A	G	6: 24,796,949	I300V	probably benign	Het
Spem1	A	G	11: 69,821,271	L189P	probably damaging	Het
Sptbn2	A	T	19: 4,748,123	R1959*	probably null	Het
Timeless	C	T	10: 128,250,060	R935W	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim24	T	C	6: 37,919,465	Y286H	possibly damaging	Het
Ttyh2	A	G	11: 114,710,193		probably benign	Het
Zbtb21	C	T	16: 97,952,627	C180Y	probably damaging	Het
Zfp746	T	C	6: 48,064,899	T298A	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCACCAGCATTTGCCACAG -3'
(R):5'- CACTAACGTGGATCTTCAGCCCTC -3'

Sequencing Primer
(F):5'- CCAGCATTTGCCACAGTTTAAAAG -3'
(R):5'- AGATCAAGTACCTGTTCCGAGTG -3'

Posted On

2013-09-03