Incidental Mutation 'R8944:Dnah11'
ID 681193
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock # R8944 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 117877982-118199043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118127646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 917 (E917A)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000084806
AA Change: E917A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: E917A

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,159,025 probably benign Het
A830018L16Rik A T 1: 11,414,482 probably benign Het
Acox1 C T 11: 116,175,214 R454H probably damaging Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Ankrd12 A C 17: 65,970,200 Y2026* probably null Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Avil G T 10: 127,010,586 G420V probably damaging Het
Bche A T 3: 73,700,675 F473I probably damaging Het
Borcs5 T C 6: 134,644,474 probably null Het
C4b T C 17: 34,742,939 Q111R probably benign Het
Carmil2 T A 8: 105,690,805 I565N probably damaging Het
Cd74 T C 18: 60,810,055 M155T probably damaging Het
Chrnd G T 1: 87,192,275 R105L probably damaging Het
Clpp G T 17: 56,993,553 E217* probably null Het
Cpq T A 15: 33,594,123 Y427N probably damaging Het
Crxos G A 7: 15,902,975 E54K possibly damaging Het
Dcaf13 A G 15: 39,138,217 R307G possibly damaging Het
Ddx55 A G 5: 124,568,725 D595G probably damaging Het
Dld T A 12: 31,340,869 I193F possibly damaging Het
Dnaic2 T A 11: 114,750,476 Y376N possibly damaging Het
Dock7 A G 4: 98,941,006 Y2078H probably damaging Het
Dscr3 T A 16: 94,501,622 I242F probably benign Het
Dusp4 A T 8: 34,807,787 N20I probably benign Het
Dzank1 A G 2: 144,491,809 L367P probably benign Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Erich3 G C 3: 154,757,055 R742S Het
Erich6 C T 3: 58,629,854 M246I probably benign Het
Fam214a A G 9: 75,004,280 Y11C probably damaging Het
Galnt16 T G 12: 80,576,540 I158S probably damaging Het
Gm28363 A G 1: 117,727,350 T100A possibly damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 T C 1: 28,777,074 I626V probably benign Het
Gm8257 A T 14: 44,656,392 Y36N probably damaging Het
Gmpr2 T C 14: 55,675,692 V142A possibly damaging Het
Grid2ip T C 5: 143,380,505 probably null Het
Hamp2 A G 7: 30,922,576 F63L possibly damaging Het
Hmga2 T C 10: 120,473,254 K66E probably damaging Het
Hspa1a T C 17: 34,971,043 T295A probably benign Het
Ift74 G A 4: 94,621,891 G53D probably damaging Het
Ighv6-7 T C 12: 114,456,083 M1V probably null Het
Ints4 T A 7: 97,534,386 D769E probably benign Het
Kif7 G A 7: 79,710,257 R411C probably damaging Het
Klhl30 T A 1: 91,359,452 Y487N probably damaging Het
Kras T C 6: 145,225,127 E174G probably benign Het
Krt84 T C 15: 101,528,748 I327V probably benign Het
Lamb3 T A 1: 193,332,217 C561* probably null Het
Lmbrd1 A G 1: 24,728,326 probably benign Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lrp2 C T 2: 69,511,004 G944D probably damaging Het
Mta3 G A 17: 83,775,717 E280K probably damaging Het
Muc5b A T 7: 141,867,378 I4236F Het
Myh9 T C 15: 77,771,232 T1175A probably benign Het
Myt1l T A 12: 29,811,565 D115E unknown Het
Naa25 A G 5: 121,414,510 N167D probably benign Het
Ncam1 G A 9: 49,520,193 P648L probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr314 A T 11: 58,786,693 D153V probably damaging Het
P3h3 G T 6: 124,855,233 A230E possibly damaging Het
Pacs2 A G 12: 113,056,856 E253G probably damaging Het
Pbld1 A T 10: 63,065,869 D57V probably benign Het
Pcsk5 T C 19: 17,474,911 T1077A probably damaging Het
Pou4f2 T A 8: 78,435,303 M224L Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Ppp1r10 T A 17: 35,930,126 M640K probably benign Het
Prdx6 A T 1: 161,241,862 probably benign Het
Rab40b A G 11: 121,359,558 probably null Het
Rassf9 T A 10: 102,545,468 M237K probably benign Het
Rbbp8nl G T 2: 180,277,976 Y604* probably null Het
Reep2 G T 18: 34,842,876 W42L possibly damaging Het
Serpinb6e A T 13: 33,833,278 M253K probably damaging Het
Shank2 A G 7: 144,070,190 Q304R probably damaging Het
Slk T C 19: 47,611,618 M120T probably damaging Het
Sphkap T A 1: 83,279,206 H274L probably benign Het
Stc1 T G 14: 69,032,435 F155V possibly damaging Het
Tbc1d12 A G 19: 38,911,066 T477A probably damaging Het
Tmem19 T A 10: 115,347,766 I54F possibly damaging Het
Tmem62 G A 2: 120,986,835 probably null Het
Ttc6 A T 12: 57,643,040 R505S Het
Ttn G T 2: 76,792,840 R15418S probably damaging Het
Ugt2a3 C A 5: 87,325,558 C500F possibly damaging Het
Ugt2b35 T C 5: 87,001,451 F187S probably benign Het
Ung T A 5: 114,131,395 I56N probably damaging Het
Vmn1r17 G T 6: 57,361,157 F25L probably benign Het
Vmn1r29 C A 6: 58,307,289 probably benign Het
Wdhd1 T C 14: 47,267,013 D368G probably benign Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wt1 G A 2: 105,127,239 G10D possibly damaging Het
Zdhhc19 G A 16: 32,497,682 G85D probably damaging Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 splice site probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 splice site probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
R7000:Dnah11 UTSW 12 118017661 missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117922018 frame shift probably null
R7101:Dnah11 UTSW 12 118068145 missense probably benign
R7106:Dnah11 UTSW 12 117961149 missense probably benign 0.15
R7203:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118041095 missense possibly damaging 0.95
R7219:Dnah11 UTSW 12 118126889 missense probably benign 0.00
R7308:Dnah11 UTSW 12 117995275 missense probably damaging 1.00
R7361:Dnah11 UTSW 12 118018742 missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117987442 missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118027477 missense probably benign 0.00
R7399:Dnah11 UTSW 12 118125785 missense probably damaging 1.00
R7404:Dnah11 UTSW 12 118104808 missense probably benign 0.36
R7473:Dnah11 UTSW 12 117903176 missense probably benign 0.19
R7545:Dnah11 UTSW 12 117931204 missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118140770 splice site probably null
R7625:Dnah11 UTSW 12 118196642 missense probably benign
R7761:Dnah11 UTSW 12 118023913 missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118041009 missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117987502 missense probably benign 0.04
R7904:Dnah11 UTSW 12 117903268 missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117966633 missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117878549 missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 118012446 missense probably benign
R8254:Dnah11 UTSW 12 117878524 missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 118027508 nonsense probably null
R8272:Dnah11 UTSW 12 118111017 missense probably benign 0.01
R8344:Dnah11 UTSW 12 118085731 missense probably benign 0.00
R8515:Dnah11 UTSW 12 117975798 missense probably damaging 1.00
R8528:Dnah11 UTSW 12 118008803 missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117878512 missense probably benign
R8676:Dnah11 UTSW 12 118190804 missense probably damaging 1.00
R8738:Dnah11 UTSW 12 118085649 critical splice donor site probably null
R8773:Dnah11 UTSW 12 117995215 missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117911029 missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8866:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8881:Dnah11 UTSW 12 118113912 missense probably benign 0.00
R8881:Dnah11 UTSW 12 118126815 missense probably benign 0.05
R8920:Dnah11 UTSW 12 118113939 missense probably damaging 0.99
R8945:Dnah11 UTSW 12 118023983 missense probably benign 0.36
R8962:Dnah11 UTSW 12 117952538 missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117954895 missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118130843 missense probably benign 0.00
R9155:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9162:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9164:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117931183 missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118190897 missense probably benign
R9205:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9208:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117987360 missense probably damaging 1.00
R9264:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R9290:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9291:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118179606 missense probably benign 0.11
R9353:Dnah11 UTSW 12 118179699 missense probably benign 0.00
R9375:Dnah11 UTSW 12 117920968 missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118047320 nonsense probably null
R9392:Dnah11 UTSW 12 118177555 missense probably benign 0.00
R9433:Dnah11 UTSW 12 118012272 missense probably damaging 1.00
RF023:Dnah11 UTSW 12 117954850 missense probably damaging 1.00
RF047:Dnah11 UTSW 12 118010083 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 117931177 missense possibly damaging 0.81
Z1176:Dnah11 UTSW 12 118127119 missense probably benign 0.00
Z1176:Dnah11 UTSW 12 118130799 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGTAGTCTGCGATGTCCAG -3'
(R):5'- TCTTCAGTATGGTGAGCTTCCC -3'

Sequencing Primer
(F):5'- ATGTCCAGGTGTGCTGCC -3'
(R):5'- ATGTTGGTCATCATTAACCCCAAC -3'
Posted On 2021-08-31