Mutagenetix > Incidental Mutations

Incidental Mutation 'R8944:Stc1'

681198

Institutional Source

Beutler Lab

Gene Symbol

Stc1

Ensembl Gene

ENSMUSG00000014813

Gene Name

stanniocalcin 1

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R8944 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69029238-69041804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 69032435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 155 (F155V)

Ref Sequence

ENSEMBL: ENSMUSP00000014957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014957]

AlphaFold

O55183

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014957
AA Change: F155V

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: F155V

Domain	Start	End	E-Value	Type
Pfam:Stanniocalcin	6	206	1.6e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	T	11: 72,159,025		probably benign	Het
A830018L16Rik	A	T	1: 11,414,482		probably benign	Het
Acox1	C	T	11: 116,175,214	R454H	probably damaging	Het
Adam18	A	G	8: 24,674,687	L4P	probably damaging	Het
AI182371	A	C	2: 35,100,610	L25R	probably damaging	Het
Ankrd12	A	C	17: 65,970,200	Y2026*	probably null	Het
Atad5	C	T	11: 80,095,698	T537M	possibly damaging	Het
Avil	G	T	10: 127,010,586	G420V	probably damaging	Het
Bche	A	T	3: 73,700,675	F473I	probably damaging	Het
Borcs5	T	C	6: 134,644,474		probably null	Het
C4b	T	C	17: 34,742,939	Q111R	probably benign	Het
Carmil2	T	A	8: 105,690,805	I565N	probably damaging	Het
Cd74	T	C	18: 60,810,055	M155T	probably damaging	Het
Chrnd	G	T	1: 87,192,275	R105L	probably damaging	Het
Clpp	G	T	17: 56,993,553	E217*	probably null	Het
Cpq	T	A	15: 33,594,123	Y427N	probably damaging	Het
Crxos	G	A	7: 15,902,975	E54K	possibly damaging	Het
Dcaf13	A	G	15: 39,138,217	R307G	possibly damaging	Het
Ddx55	A	G	5: 124,568,725	D595G	probably damaging	Het
Dld	T	A	12: 31,340,869	I193F	possibly damaging	Het
Dnah11	T	G	12: 118,127,646	E917A	possibly damaging	Het
Dnaic2	T	A	11: 114,750,476	Y376N	possibly damaging	Het
Dock7	A	G	4: 98,941,006	Y2078H	probably damaging	Het
Dscr3	T	A	16: 94,501,622	I242F	probably benign	Het
Dusp4	A	T	8: 34,807,787	N20I	probably benign	Het
Dzank1	A	G	2: 144,491,809	L367P	probably benign	Het
Eea1	T	A	10: 95,996,960	D222E	probably damaging	Het
Erich3	G	C	3: 154,757,055	R742S		Het
Erich6	C	T	3: 58,629,854	M246I	probably benign	Het
Fam214a	A	G	9: 75,004,280	Y11C	probably damaging	Het
Galnt16	T	G	12: 80,576,540	I158S	probably damaging	Het
Gm28363	A	G	1: 117,727,350	T100A	possibly damaging	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gm597	T	C	1: 28,777,074	I626V	probably benign	Het
Gm8257	A	T	14: 44,656,392	Y36N	probably damaging	Het
Gmpr2	T	C	14: 55,675,692	V142A	possibly damaging	Het
Grid2ip	T	C	5: 143,380,505		probably null	Het
Hamp2	A	G	7: 30,922,576	F63L	possibly damaging	Het
Hmga2	T	C	10: 120,473,254	K66E	probably damaging	Het
Hspa1a	T	C	17: 34,971,043	T295A	probably benign	Het
Ift74	G	A	4: 94,621,891	G53D	probably damaging	Het
Ighv6-7	T	C	12: 114,456,083	M1V	probably null	Het
Ints4	T	A	7: 97,534,386	D769E	probably benign	Het
Kif7	G	A	7: 79,710,257	R411C	probably damaging	Het
Klhl30	T	A	1: 91,359,452	Y487N	probably damaging	Het
Kras	T	C	6: 145,225,127	E174G	probably benign	Het
Krt84	T	C	15: 101,528,748	I327V	probably benign	Het
Lamb3	T	A	1: 193,332,217	C561*	probably null	Het
Lmbrd1	A	G	1: 24,728,326		probably benign	Het
Lmnb1	T	A	18: 56,743,259	S480T	probably benign	Het
Lrp2	C	T	2: 69,511,004	G944D	probably damaging	Het
Mta3	G	A	17: 83,775,717	E280K	probably damaging	Het
Muc5b	A	T	7: 141,867,378	I4236F		Het
Myh9	T	C	15: 77,771,232	T1175A	probably benign	Het
Myt1l	T	A	12: 29,811,565	D115E	unknown	Het
Naa25	A	G	5: 121,414,510	N167D	probably benign	Het
Ncam1	G	A	9: 49,520,193	P648L	probably damaging	Het
Olfr1395	T	C	11: 49,148,439	Y61H	probably damaging	Het
Olfr314	A	T	11: 58,786,693	D153V	probably damaging	Het
P3h3	G	T	6: 124,855,233	A230E	possibly damaging	Het
Pacs2	A	G	12: 113,056,856	E253G	probably damaging	Het
Pbld1	A	T	10: 63,065,869	D57V	probably benign	Het
Pcsk5	T	C	19: 17,474,911	T1077A	probably damaging	Het
Pou4f2	T	A	8: 78,435,303	M224L		Het
Ppcdc	C	T	9: 57,434,982	R19H	probably benign	Het
Ppp1r10	T	A	17: 35,930,126	M640K	probably benign	Het
Prdx6	A	T	1: 161,241,862		probably benign	Het
Rab40b	A	G	11: 121,359,558		probably null	Het
Rassf9	T	A	10: 102,545,468	M237K	probably benign	Het
Rbbp8nl	G	T	2: 180,277,976	Y604*	probably null	Het
Reep2	G	T	18: 34,842,876	W42L	possibly damaging	Het
Serpinb6e	A	T	13: 33,833,278	M253K	probably damaging	Het
Shank2	A	G	7: 144,070,190	Q304R	probably damaging	Het
Slk	T	C	19: 47,611,618	M120T	probably damaging	Het
Sphkap	T	A	1: 83,279,206	H274L	probably benign	Het
Tbc1d12	A	G	19: 38,911,066	T477A	probably damaging	Het
Tmem19	T	A	10: 115,347,766	I54F	possibly damaging	Het
Tmem62	G	A	2: 120,986,835		probably null	Het
Ttc6	A	T	12: 57,643,040	R505S		Het
Ttn	G	T	2: 76,792,840	R15418S	probably damaging	Het
Ugt2a3	C	A	5: 87,325,558	C500F	possibly damaging	Het
Ugt2b35	T	C	5: 87,001,451	F187S	probably benign	Het
Ung	T	A	5: 114,131,395	I56N	probably damaging	Het
Vmn1r17	G	T	6: 57,361,157	F25L	probably benign	Het
Vmn1r29	C	A	6: 58,307,289		probably benign	Het
Wdhd1	T	C	14: 47,267,013	D368G	probably benign	Het
Wdr3	A	T	3: 100,149,943	I448N	probably damaging	Het
Wdr47	T	A	3: 108,643,164	M835K	possibly damaging	Het
Wt1	G	A	2: 105,127,239	G10D	possibly damaging	Het
Zdhhc19	G	A	16: 32,497,682	G85D	probably damaging	Het

Other mutations in Stc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Stc1	APN	14	69038277	missense	probably benign	0.21
IGL01918:Stc1	APN	14	69031654	splice site	probably benign
R0318:Stc1	UTSW	14	69038418	missense	probably damaging	0.98
R0322:Stc1	UTSW	14	69029409	missense	probably benign	0.08
R1699:Stc1	UTSW	14	69038327	missense	probably benign	0.00
R2005:Stc1	UTSW	14	69031647	critical splice donor site	probably null
R3801:Stc1	UTSW	14	69038475	missense	probably benign
R3803:Stc1	UTSW	14	69038475	missense	probably benign
R4184:Stc1	UTSW	14	69029385	start gained	probably benign
R5206:Stc1	UTSW	14	69031599	missense	probably damaging	1.00
R5927:Stc1	UTSW	14	69032373	missense	probably benign	0.02
R6059:Stc1	UTSW	14	69032438	missense	probably damaging	1.00
R6185:Stc1	UTSW	14	69038364	missense	probably damaging	1.00
R7722:Stc1	UTSW	14	69032280	missense	possibly damaging	0.76
R8001:Stc1	UTSW	14	69038395	missense	probably benign	0.34
R8870:Stc1	UTSW	14	69038376	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCTGGCAGGGAAAAGCATTTG -3'
(R):5'- TTCAGGCTTATGGTAAGAACTGG -3'

Sequencing Primer
(F):5'- GAGCTTAAAGTGCATCGCC -3'
(R):5'- TCTGGTTATGGTGGCCAA -3'

Posted On

2021-08-31