Incidental Mutation 'R8944:C4b'
ID 681205
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement component 4B (Chido blood group)
Synonyms C4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8944 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34728380-34743882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34742939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 111 (Q111R)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: Q111R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: Q111R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (88/88)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,159,025 probably benign Het
A830018L16Rik A T 1: 11,414,482 probably benign Het
Acox1 C T 11: 116,175,214 R454H probably damaging Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Ankrd12 A C 17: 65,970,200 Y2026* probably null Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Avil G T 10: 127,010,586 G420V probably damaging Het
Bche A T 3: 73,700,675 F473I probably damaging Het
Borcs5 T C 6: 134,644,474 probably null Het
Carmil2 T A 8: 105,690,805 I565N probably damaging Het
Cd74 T C 18: 60,810,055 M155T probably damaging Het
Chrnd G T 1: 87,192,275 R105L probably damaging Het
Clpp G T 17: 56,993,553 E217* probably null Het
Cpq T A 15: 33,594,123 Y427N probably damaging Het
Crxos G A 7: 15,902,975 E54K possibly damaging Het
Dcaf13 A G 15: 39,138,217 R307G possibly damaging Het
Ddx55 A G 5: 124,568,725 D595G probably damaging Het
Dld T A 12: 31,340,869 I193F possibly damaging Het
Dnah11 T G 12: 118,127,646 E917A possibly damaging Het
Dnaic2 T A 11: 114,750,476 Y376N possibly damaging Het
Dock7 A G 4: 98,941,006 Y2078H probably damaging Het
Dscr3 T A 16: 94,501,622 I242F probably benign Het
Dusp4 A T 8: 34,807,787 N20I probably benign Het
Dzank1 A G 2: 144,491,809 L367P probably benign Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Erich3 G C 3: 154,757,055 R742S Het
Erich6 C T 3: 58,629,854 M246I probably benign Het
Fam214a A G 9: 75,004,280 Y11C probably damaging Het
Galnt16 T G 12: 80,576,540 I158S probably damaging Het
Gm28363 A G 1: 117,727,350 T100A possibly damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 T C 1: 28,777,074 I626V probably benign Het
Gm8257 A T 14: 44,656,392 Y36N probably damaging Het
Gmpr2 T C 14: 55,675,692 V142A possibly damaging Het
Grid2ip T C 5: 143,380,505 probably null Het
Hamp2 A G 7: 30,922,576 F63L possibly damaging Het
Hmga2 T C 10: 120,473,254 K66E probably damaging Het
Hspa1a T C 17: 34,971,043 T295A probably benign Het
Ift74 G A 4: 94,621,891 G53D probably damaging Het
Ighv6-7 T C 12: 114,456,083 M1V probably null Het
Ints4 T A 7: 97,534,386 D769E probably benign Het
Kif7 G A 7: 79,710,257 R411C probably damaging Het
Klhl30 T A 1: 91,359,452 Y487N probably damaging Het
Kras T C 6: 145,225,127 E174G probably benign Het
Krt84 T C 15: 101,528,748 I327V probably benign Het
Lamb3 T A 1: 193,332,217 C561* probably null Het
Lmbrd1 A G 1: 24,728,326 probably benign Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lrp2 C T 2: 69,511,004 G944D probably damaging Het
Mta3 G A 17: 83,775,717 E280K probably damaging Het
Muc5b A T 7: 141,867,378 I4236F Het
Myh9 T C 15: 77,771,232 T1175A probably benign Het
Myt1l T A 12: 29,811,565 D115E unknown Het
Naa25 A G 5: 121,414,510 N167D probably benign Het
Ncam1 G A 9: 49,520,193 P648L probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr314 A T 11: 58,786,693 D153V probably damaging Het
P3h3 G T 6: 124,855,233 A230E possibly damaging Het
Pacs2 A G 12: 113,056,856 E253G probably damaging Het
Pbld1 A T 10: 63,065,869 D57V probably benign Het
Pcsk5 T C 19: 17,474,911 T1077A probably damaging Het
Pou4f2 T A 8: 78,435,303 M224L Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Ppp1r10 T A 17: 35,930,126 M640K probably benign Het
Prdx6 A T 1: 161,241,862 probably benign Het
Rab40b A G 11: 121,359,558 probably null Het
Rassf9 T A 10: 102,545,468 M237K probably benign Het
Rbbp8nl G T 2: 180,277,976 Y604* probably null Het
Reep2 G T 18: 34,842,876 W42L possibly damaging Het
Serpinb6e A T 13: 33,833,278 M253K probably damaging Het
Shank2 A G 7: 144,070,190 Q304R probably damaging Het
Slk T C 19: 47,611,618 M120T probably damaging Het
Sphkap T A 1: 83,279,206 H274L probably benign Het
Stc1 T G 14: 69,032,435 F155V possibly damaging Het
Tbc1d12 A G 19: 38,911,066 T477A probably damaging Het
Tmem19 T A 10: 115,347,766 I54F possibly damaging Het
Tmem62 G A 2: 120,986,835 probably null Het
Ttc6 A T 12: 57,643,040 R505S Het
Ttn G T 2: 76,792,840 R15418S probably damaging Het
Ugt2a3 C A 5: 87,325,558 C500F possibly damaging Het
Ugt2b35 T C 5: 87,001,451 F187S probably benign Het
Ung T A 5: 114,131,395 I56N probably damaging Het
Vmn1r17 G T 6: 57,361,157 F25L probably benign Het
Vmn1r29 C A 6: 58,307,289 probably benign Het
Wdhd1 T C 14: 47,267,013 D368G probably benign Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wt1 G A 2: 105,127,239 G10D possibly damaging Het
Zdhhc19 G A 16: 32,497,682 G85D probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8558:C4b UTSW 17 34736567 missense probably damaging 1.00
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
R8853:C4b UTSW 17 34729905 missense possibly damaging 0.91
R8934:C4b UTSW 17 34732984 missense possibly damaging 0.78
R8960:C4b UTSW 17 34733918 missense probably damaging 1.00
R8982:C4b UTSW 17 34734364 critical splice donor site probably null
R9104:C4b UTSW 17 34729259 missense probably benign 0.39
R9114:C4b UTSW 17 34729430 missense probably damaging 0.99
R9348:C4b UTSW 17 34733185 missense probably benign 0.01
R9428:C4b UTSW 17 34730911 missense possibly damaging 0.52
R9533:C4b UTSW 17 34737724 nonsense probably null
R9591:C4b UTSW 17 34738955 missense probably benign 0.00
R9678:C4b UTSW 17 34741789 critical splice donor site probably null
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAATCAAGCCCCTAGGGTGG -3'
(R):5'- TCTCTCCTCTGGCACAATGG -3'

Sequencing Primer
(F):5'- GAGTTGCCTTACATAGAAGGCACC -3'
(R):5'- TCTGGCACAATGGCCTTG -3'
Posted On 2021-08-31