Incidental Mutation 'R8944:Reep2'
ID 681211
Institutional Source Beutler Lab
Gene Symbol Reep2
Ensembl Gene ENSMUSG00000038555
Gene Name receptor accessory protein 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock # R8944 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34840589-34847463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34842876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 42 (W42L)
Ref Sequence ENSEMBL: ENSMUSP00000036065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043484] [ENSMUST00000043775] [ENSMUST00000225195]
AlphaFold Q8VCD6
Predicted Effect possibly damaging
Transcript: ENSMUST00000043484
AA Change: W42L

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036065
Gene: ENSMUSG00000038555
AA Change: W42L

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.4e-36 PFAM
low complexity region 129 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043775
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225195
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,159,025 probably benign Het
A830018L16Rik A T 1: 11,414,482 probably benign Het
Acox1 C T 11: 116,175,214 R454H probably damaging Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
AI182371 A C 2: 35,100,610 L25R probably damaging Het
Ankrd12 A C 17: 65,970,200 Y2026* probably null Het
Atad5 C T 11: 80,095,698 T537M possibly damaging Het
Avil G T 10: 127,010,586 G420V probably damaging Het
Bche A T 3: 73,700,675 F473I probably damaging Het
Borcs5 T C 6: 134,644,474 probably null Het
C4b T C 17: 34,742,939 Q111R probably benign Het
Carmil2 T A 8: 105,690,805 I565N probably damaging Het
Cd74 T C 18: 60,810,055 M155T probably damaging Het
Chrnd G T 1: 87,192,275 R105L probably damaging Het
Clpp G T 17: 56,993,553 E217* probably null Het
Cpq T A 15: 33,594,123 Y427N probably damaging Het
Crxos G A 7: 15,902,975 E54K possibly damaging Het
Dcaf13 A G 15: 39,138,217 R307G possibly damaging Het
Ddx55 A G 5: 124,568,725 D595G probably damaging Het
Dld T A 12: 31,340,869 I193F possibly damaging Het
Dnah11 T G 12: 118,127,646 E917A possibly damaging Het
Dnaic2 T A 11: 114,750,476 Y376N possibly damaging Het
Dock7 A G 4: 98,941,006 Y2078H probably damaging Het
Dscr3 T A 16: 94,501,622 I242F probably benign Het
Dusp4 A T 8: 34,807,787 N20I probably benign Het
Dzank1 A G 2: 144,491,809 L367P probably benign Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Erich3 G C 3: 154,757,055 R742S Het
Erich6 C T 3: 58,629,854 M246I probably benign Het
Fam214a A G 9: 75,004,280 Y11C probably damaging Het
Galnt16 T G 12: 80,576,540 I158S probably damaging Het
Gm28363 A G 1: 117,727,350 T100A possibly damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gm597 T C 1: 28,777,074 I626V probably benign Het
Gm8257 A T 14: 44,656,392 Y36N probably damaging Het
Gmpr2 T C 14: 55,675,692 V142A possibly damaging Het
Grid2ip T C 5: 143,380,505 probably null Het
Hamp2 A G 7: 30,922,576 F63L possibly damaging Het
Hmga2 T C 10: 120,473,254 K66E probably damaging Het
Hspa1a T C 17: 34,971,043 T295A probably benign Het
Ift74 G A 4: 94,621,891 G53D probably damaging Het
Ighv6-7 T C 12: 114,456,083 M1V probably null Het
Ints4 T A 7: 97,534,386 D769E probably benign Het
Kif7 G A 7: 79,710,257 R411C probably damaging Het
Klhl30 T A 1: 91,359,452 Y487N probably damaging Het
Kras T C 6: 145,225,127 E174G probably benign Het
Krt84 T C 15: 101,528,748 I327V probably benign Het
Lamb3 T A 1: 193,332,217 C561* probably null Het
Lmbrd1 A G 1: 24,728,326 probably benign Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lrp2 C T 2: 69,511,004 G944D probably damaging Het
Mta3 G A 17: 83,775,717 E280K probably damaging Het
Muc5b A T 7: 141,867,378 I4236F Het
Myh9 T C 15: 77,771,232 T1175A probably benign Het
Myt1l T A 12: 29,811,565 D115E unknown Het
Naa25 A G 5: 121,414,510 N167D probably benign Het
Ncam1 G A 9: 49,520,193 P648L probably damaging Het
Olfr1395 T C 11: 49,148,439 Y61H probably damaging Het
Olfr314 A T 11: 58,786,693 D153V probably damaging Het
P3h3 G T 6: 124,855,233 A230E possibly damaging Het
Pacs2 A G 12: 113,056,856 E253G probably damaging Het
Pbld1 A T 10: 63,065,869 D57V probably benign Het
Pcsk5 T C 19: 17,474,911 T1077A probably damaging Het
Pou4f2 T A 8: 78,435,303 M224L Het
Ppcdc C T 9: 57,434,982 R19H probably benign Het
Ppp1r10 T A 17: 35,930,126 M640K probably benign Het
Prdx6 A T 1: 161,241,862 probably benign Het
Rab40b A G 11: 121,359,558 probably null Het
Rassf9 T A 10: 102,545,468 M237K probably benign Het
Rbbp8nl G T 2: 180,277,976 Y604* probably null Het
Serpinb6e A T 13: 33,833,278 M253K probably damaging Het
Shank2 A G 7: 144,070,190 Q304R probably damaging Het
Slk T C 19: 47,611,618 M120T probably damaging Het
Sphkap T A 1: 83,279,206 H274L probably benign Het
Stc1 T G 14: 69,032,435 F155V possibly damaging Het
Tbc1d12 A G 19: 38,911,066 T477A probably damaging Het
Tmem19 T A 10: 115,347,766 I54F possibly damaging Het
Tmem62 G A 2: 120,986,835 probably null Het
Ttc6 A T 12: 57,643,040 R505S Het
Ttn G T 2: 76,792,840 R15418S probably damaging Het
Ugt2a3 C A 5: 87,325,558 C500F possibly damaging Het
Ugt2b35 T C 5: 87,001,451 F187S probably benign Het
Ung T A 5: 114,131,395 I56N probably damaging Het
Vmn1r17 G T 6: 57,361,157 F25L probably benign Het
Vmn1r29 C A 6: 58,307,289 probably benign Het
Wdhd1 T C 14: 47,267,013 D368G probably benign Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wt1 G A 2: 105,127,239 G10D possibly damaging Het
Zdhhc19 G A 16: 32,497,682 G85D probably damaging Het
Other mutations in Reep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Reep2 APN 18 34846249 missense probably benign
IGL02244:Reep2 APN 18 34840754 unclassified probably benign
R0624:Reep2 UTSW 18 34840771 missense probably benign 0.02
R2005:Reep2 UTSW 18 34845621 missense probably damaging 1.00
R2910:Reep2 UTSW 18 34845690 critical splice donor site probably null
R2911:Reep2 UTSW 18 34845690 critical splice donor site probably null
R5642:Reep2 UTSW 18 34846218 missense probably benign
R6709:Reep2 UTSW 18 34846210 missense probably benign 0.10
R7029:Reep2 UTSW 18 34845289 missense probably null 0.22
R8327:Reep2 UTSW 18 34842513 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATGCAGGCTTGGTATGATTG -3'
(R):5'- TCATCATGAATCTAGCCTGGGTC -3'

Sequencing Primer
(F):5'- GAGGCCTTGGGTATCTCTCC -3'
(R):5'- GAATCTAGCCTGGGTCCAAATCTG -3'
Posted On 2021-08-31