Incidental Mutation 'R8945:G3bp2'
ID 681231
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene Name GTPase activating protein (SH3 domain) binding protein 2
Synonyms G3BP, E430034L04Rik, G3BP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8945 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92052146-92083719 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92068422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 85 (T85I)
Ref Sequence ENSEMBL: ENSMUSP00000132469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000201820] [ENSMUST00000202123] [ENSMUST00000202258]
AlphaFold P97379
Predicted Effect probably damaging
Transcript: ENSMUST00000113127
AA Change: T85I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164378
AA Change: T85I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167918
AA Change: T85I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169094
AA Change: T85I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201820
AA Change: T85I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144404
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 117 9.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202123
AA Change: T85I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143804
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202258
AA Change: T85I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405
AA Change: T85I

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Meta Mutation Damage Score 0.9167 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,240,331 K709N probably null Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Atp6v0a2 G T 5: 124,646,649 A291S probably damaging Het
Bcl9l G T 9: 44,500,941 V38L possibly damaging Het
Bmp1 T C 14: 70,490,190 Y651C probably damaging Het
Btnl9 T C 11: 49,174,834 E398G probably benign Het
C2cd3 A T 7: 100,391,079 N285I possibly damaging Het
Cavin1 T C 11: 100,958,833 T324A probably damaging Het
Ccdc73 A G 2: 104,991,367 T554A probably benign Het
Clcn1 A T 6: 42,286,767 M1L possibly damaging Het
Clec18a A T 8: 111,081,569 S77T possibly damaging Het
Dhx32 A G 7: 133,722,147 probably null Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah10 A C 5: 124,813,942 E3199A probably damaging Het
Dnah11 G T 12: 118,023,983 L2395I probably benign Het
Dthd1 A T 5: 62,849,753 Y599F probably benign Het
Dusp26 G A 8: 31,096,339 R196K unknown Het
Dyrk1a A G 16: 94,666,007 Y140C probably damaging Het
Elmo1 T A 13: 20,582,268 Y588* probably null Het
Eml6 T A 11: 29,753,110 T1603S probably damaging Het
Fam162b T C 10: 51,590,373 T17A probably benign Het
Fnbp1 T A 2: 31,105,334 K29N probably damaging Het
Fzd4 A T 7: 89,407,584 I280L possibly damaging Het
Gm13283 C T 4: 88,760,886 A38V probably benign Het
Gm17359 A G 3: 79,345,505 H9R probably benign Het
Hps3 T A 3: 20,014,060 H610L probably damaging Het
Ifnlr1 T G 4: 135,704,298 L266R probably damaging Het
Jak1 A T 4: 101,162,912 D683E probably benign Het
Lrrc1 G A 9: 77,435,091 T412M probably damaging Het
Mdga1 G T 17: 29,839,985 probably benign Het
Med26 T C 8: 72,497,090 K55R probably benign Het
Mturn C A 6: 54,689,032 C63* probably null Het
Myo1h A C 5: 114,332,723 D381A probably damaging Het
Nectin1 A G 9: 43,791,940 D165G probably benign Het
Nktr T A 9: 121,746,492 D330E possibly damaging Het
Oprm1 A T 10: 6,832,644 probably benign Het
Papola T A 12: 105,809,687 probably benign Het
Pdcl2 A T 5: 76,317,828 C134S probably damaging Het
Plch1 T C 3: 63,731,618 Y478C probably benign Het
Rev1 A T 1: 38,083,743 W465R probably damaging Het
Rp1 T A 1: 4,349,594 I432F probably benign Het
Samd14 A C 11: 95,021,201 D168A probably damaging Het
Sdk1 G T 5: 141,613,180 C200F probably benign Het
Spsb1 T C 4: 149,907,018 Y31C possibly damaging Het
Spz1 T C 13: 92,574,991 K326E possibly damaging Het
Tcaf1 C T 6: 42,686,373 S191N probably benign Het
Tex15 A G 8: 33,574,696 S1385G probably benign Het
Tmem38a C T 8: 72,584,726 A194V probably damaging Het
Trappc9 T C 15: 73,058,096 N137S probably benign Het
Tshr T C 12: 91,538,223 L645P probably damaging Het
Tspyl4 T A 10: 34,297,465 probably benign Het
Unc13a T A 8: 71,647,953 I1064F probably damaging Het
Utp20 G A 10: 88,792,670 Q921* probably null Het
Vps13a A T 19: 16,664,750 I2171N probably damaging Het
Zfp40 A G 17: 23,182,227 V14A probably benign Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1067:G3bp2 UTSW 5 92063328 splice site probably benign
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R2294:G3bp2 UTSW 5 92058028 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5518:G3bp2 UTSW 5 92068488 missense probably benign 0.00
R5680:G3bp2 UTSW 5 92068360 missense probably damaging 1.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
R8769:G3bp2 UTSW 5 92083497 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCAAATCCAAGCCTGTAGGAAG -3'
(R):5'- TCAAGACGCATTAGGACTTCTTG -3'

Sequencing Primer
(F):5'- TCCAAGCCTGTAGGAAGAAACTCTAG -3'
(R):5'- ACGCATTAGGACTTCTTGTATAGAGG -3'
Posted On 2021-08-31