Incidental Mutation 'R8945:Bmp1'
ID 681266
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 068713-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8945 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70727630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 651 (Y651C)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: Y651C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y651C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Meta Mutation Damage Score 0.9256 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aopep G T 13: 63,388,145 (GRCm39) K709N probably null Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Atp6v0a2 G T 5: 124,784,589 (GRCm39) A291S probably damaging Het
Bcl9l G T 9: 44,412,238 (GRCm39) V38L possibly damaging Het
Btnl9 T C 11: 49,065,661 (GRCm39) E398G probably benign Het
C2cd3 A T 7: 100,040,286 (GRCm39) N285I possibly damaging Het
Cavin1 T C 11: 100,849,659 (GRCm39) T324A probably damaging Het
Ccdc73 A G 2: 104,821,712 (GRCm39) T554A probably benign Het
Clcn1 A T 6: 42,263,701 (GRCm39) M1L possibly damaging Het
Clec18a A T 8: 111,808,201 (GRCm39) S77T possibly damaging Het
Dhx32 A G 7: 133,323,876 (GRCm39) probably null Het
Dmxl1 C G 18: 50,072,639 (GRCm39) N2744K probably damaging Het
Dnah10 A C 5: 124,891,006 (GRCm39) E3199A probably damaging Het
Dnah11 G T 12: 117,987,718 (GRCm39) L2395I probably benign Het
Dthd1 A T 5: 63,007,096 (GRCm39) Y599F probably benign Het
Dusp26 G A 8: 31,586,367 (GRCm39) R196K unknown Het
Dyrk1a A G 16: 94,466,866 (GRCm39) Y140C probably damaging Het
Elmo1 T A 13: 20,766,438 (GRCm39) Y588* probably null Het
Eml6 T A 11: 29,703,110 (GRCm39) T1603S probably damaging Het
Fam162b T C 10: 51,466,469 (GRCm39) T17A probably benign Het
Fnbp1 T A 2: 30,995,346 (GRCm39) K29N probably damaging Het
Fzd4 A T 7: 89,056,792 (GRCm39) I280L possibly damaging Het
G3bp2 G A 5: 92,216,281 (GRCm39) T85I probably damaging Het
Gm13283 C T 4: 88,679,123 (GRCm39) A38V probably benign Het
Hps3 T A 3: 20,068,224 (GRCm39) H610L probably damaging Het
Ifnlr1 T G 4: 135,431,609 (GRCm39) L266R probably damaging Het
Jak1 A T 4: 101,020,109 (GRCm39) D683E probably benign Het
Lrrc1 G A 9: 77,342,373 (GRCm39) T412M probably damaging Het
Mdga1 G T 17: 30,058,959 (GRCm39) probably benign Het
Med26 T C 8: 73,250,934 (GRCm39) K55R probably benign Het
Mturn C A 6: 54,666,017 (GRCm39) C63* probably null Het
Myo1h A C 5: 114,470,784 (GRCm39) D381A probably damaging Het
Nectin1 A G 9: 43,703,237 (GRCm39) D165G probably benign Het
Nktr T A 9: 121,575,558 (GRCm39) D330E possibly damaging Het
Oprm1 A T 10: 6,782,644 (GRCm39) probably benign Het
Papola T A 12: 105,775,946 (GRCm39) probably benign Het
Pdcl2 A T 5: 76,465,675 (GRCm39) C134S probably damaging Het
Plch1 T C 3: 63,639,039 (GRCm39) Y478C probably benign Het
Rev1 A T 1: 38,122,824 (GRCm39) W465R probably damaging Het
Rp1 T A 1: 4,419,817 (GRCm39) I432F probably benign Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Sdk1 G T 5: 141,598,935 (GRCm39) C200F probably benign Het
Spmip2 A G 3: 79,252,812 (GRCm39) H9R probably benign Het
Spsb1 T C 4: 149,991,475 (GRCm39) Y31C possibly damaging Het
Spz1 T C 13: 92,711,499 (GRCm39) K326E possibly damaging Het
Tcaf1 C T 6: 42,663,307 (GRCm39) S191N probably benign Het
Tex15 A G 8: 34,064,724 (GRCm39) S1385G probably benign Het
Tmem38a C T 8: 73,338,570 (GRCm39) A194V probably damaging Het
Trappc9 T C 15: 72,929,945 (GRCm39) N137S probably benign Het
Tshr T C 12: 91,504,997 (GRCm39) L645P probably damaging Het
Tspyl4 T A 10: 34,173,461 (GRCm39) probably benign Het
Unc13a T A 8: 72,100,597 (GRCm39) I1064F probably damaging Het
Utp20 G A 10: 88,628,532 (GRCm39) Q921* probably null Het
Vps13a A T 19: 16,642,114 (GRCm39) I2171N probably damaging Het
Zfp40 A G 17: 23,401,201 (GRCm39) V14A probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTGAGAAGAAGTGGGCC -3'
(R):5'- ACAGAAGCTCAGAGGGCTTG -3'

Sequencing Primer
(F):5'- CTTGAAGCCCTTTTTGGACACAG -3'
(R):5'- TCGCAAAGGAGGCTCTGCAG -3'
Posted On 2021-08-31