Incidental Mutation 'R8946:Intu'
ID681282
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8946 (G1)
Quality Score91.0077
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40683359 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 425 (A425V)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect possibly damaging
Transcript: ENSMUST00000091186
AA Change: A425V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: A425V

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Ceacam14 A G 7: 17,814,074 I30V probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Fmnl1 T C 11: 103,180,915 Y83H probably damaging Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Nphs1 A G 7: 30,463,200 N368S probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Olfr857 C T 9: 19,713,589 T254I probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Skint7 A G 4: 111,982,001 N164S possibly damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCAGCCCAGCAGTTCTTC -3'
(R):5'- TGATGCTTATTTGGGACCCC -3'

Sequencing Primer
(F):5'- AGCAGTTCTTCCCTGGTGTAGC -3'
(R):5'- TGGGACCCCTAAGATTACCTTGAG -3'
Posted On2021-08-31